Incidental Mutation 'R0589:Mef2a'
ID55870
Institutional Source Beutler Lab
Gene Symbol Mef2a
Ensembl Gene ENSMUSG00000030557
Gene Namemyocyte enhancer factor 2A
SynonymsA430079H05Rik
MMRRC Submission 038779-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0589 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location67231163-67372858 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 67235148 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 406 (S406*)
Ref Sequence ENSEMBL: ENSMUSP00000117496 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032776] [ENSMUST00000072460] [ENSMUST00000076325] [ENSMUST00000107476] [ENSMUST00000135493] [ENSMUST00000156690] [ENSMUST00000207715] [ENSMUST00000208512]
Predicted Effect probably null
Transcript: ENSMUST00000032776
AA Change: S400*
SMART Domains Protein: ENSMUSP00000032776
Gene: ENSMUSG00000030557
AA Change: S400*

DomainStartEndE-ValueType
MADS 1 60 6.15e-37 SMART
Pfam:HJURP_C 90 155 5.2e-30 PFAM
low complexity region 161 181 N/A INTRINSIC
low complexity region 255 265 N/A INTRINSIC
low complexity region 301 316 N/A INTRINSIC
low complexity region 412 431 N/A INTRINSIC
low complexity region 438 457 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000072460
SMART Domains Protein: ENSMUSP00000138645
Gene: ENSMUSG00000030557

DomainStartEndE-ValueType
MADS 1 60 6.15e-37 SMART
Predicted Effect probably null
Transcript: ENSMUST00000076325
AA Change: S400*
SMART Domains Protein: ENSMUSP00000075664
Gene: ENSMUSG00000030557
AA Change: S400*

DomainStartEndE-ValueType
MADS 1 60 6.15e-37 SMART
Pfam:HJURP_C 90 155 5.2e-30 PFAM
low complexity region 161 181 N/A INTRINSIC
low complexity region 255 265 N/A INTRINSIC
low complexity region 301 316 N/A INTRINSIC
low complexity region 412 431 N/A INTRINSIC
low complexity region 438 457 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107476
AA Change: S398*
SMART Domains Protein: ENSMUSP00000103100
Gene: ENSMUSG00000030557
AA Change: S398*

DomainStartEndE-ValueType
MADS 1 60 6.15e-37 SMART
Pfam:HJURP_C 90 153 3.7e-8 PFAM
low complexity region 159 179 N/A INTRINSIC
low complexity region 253 263 N/A INTRINSIC
low complexity region 299 314 N/A INTRINSIC
low complexity region 410 429 N/A INTRINSIC
low complexity region 436 455 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000135493
AA Change: S406*
SMART Domains Protein: ENSMUSP00000138566
Gene: ENSMUSG00000030557
AA Change: S406*

DomainStartEndE-ValueType
MADS 1 60 6.15e-37 SMART
Pfam:HJURP_C 90 153 3.7e-8 PFAM
low complexity region 159 179 N/A INTRINSIC
low complexity region 253 263 N/A INTRINSIC
low complexity region 288 294 N/A INTRINSIC
low complexity region 307 322 N/A INTRINSIC
low complexity region 418 437 N/A INTRINSIC
low complexity region 444 463 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000156690
AA Change: S406*
SMART Domains Protein: ENSMUSP00000117496
Gene: ENSMUSG00000030557
AA Change: S406*

DomainStartEndE-ValueType
MADS 1 60 6.15e-37 SMART
Pfam:HJURP_C 90 152 1.3e-8 PFAM
low complexity region 159 179 N/A INTRINSIC
low complexity region 253 263 N/A INTRINSIC
low complexity region 288 294 N/A INTRINSIC
low complexity region 307 322 N/A INTRINSIC
low complexity region 418 437 N/A INTRINSIC
low complexity region 444 463 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207715
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207794
Predicted Effect probably benign
Transcript: ENSMUST00000208512
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208569
Meta Mutation Damage Score 0.572 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.1%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a DNA-binding transcription factor that activates many muscle-specific, growth factor-induced, and stress-induced genes. The encoded protein can act as a homodimer or as a heterodimer and is involved in several cellular processes, including muscle development, neuronal differentiation, cell growth control, and apoptosis. Defects in this gene could be a cause of autosomal dominant coronary artery disease 1 with myocardial infarction (ADCAD1). Several transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jan 2010]
PHENOTYPE: Inactivation of this gene results in cardiac sudden death. Mice dying in the early postnatal period exhibit ventricular dilation, while mice dying in adulthood show a reduced number of mitochondria in the heart. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b G T 11: 109,942,268 A1202E probably damaging Het
Abcc12 A T 8: 86,560,472 I155N possibly damaging Het
Atf4 T A 15: 80,256,439 H47Q probably damaging Het
Atm T A 9: 53,490,192 D1459V possibly damaging Het
Bicral A G 17: 46,801,596 S893P probably benign Het
Camk2a G A 18: 60,963,964 probably null Het
Cebpz G A 17: 78,936,879 T51I probably damaging Het
Cers5 A T 15: 99,740,956 D208E probably damaging Het
Cyp1a2 T C 9: 57,679,062 D391G possibly damaging Het
Dct G T 14: 118,043,270 F111L probably benign Het
Ddb1 T G 19: 10,621,716 I529S probably benign Het
Dhx9 G T 1: 153,472,291 Q361K probably damaging Het
Erbin G T 13: 103,886,287 R15S probably damaging Het
F13b T C 1: 139,506,933 S146P possibly damaging Het
Fam166b T C 4: 43,427,355 probably benign Het
Fam208a T C 14: 27,461,150 I522T probably benign Het
Ggnbp2 A T 11: 84,836,451 C520S probably damaging Het
Gpx3 A G 11: 54,909,503 I208V probably benign Het
Grk3 A G 5: 112,928,763 probably benign Het
Heatr9 T C 11: 83,514,690 probably benign Het
Heg1 T G 16: 33,731,707 I762R probably damaging Het
Ints11 A T 4: 155,886,886 T264S probably damaging Het
Ints14 T C 9: 64,979,831 L348P probably damaging Het
Marf1 C A 16: 14,142,055 probably benign Het
Med13 A G 11: 86,283,249 Y1808H probably damaging Het
Mrpl45 A T 11: 97,323,888 T134S probably benign Het
Myh8 A G 11: 67,298,627 I1210V probably benign Het
Nsd3 T C 8: 25,641,287 S223P probably damaging Het
Olfr1105 A T 2: 87,034,115 Y35* probably null Het
Olfr1220 A G 2: 89,097,262 F222L probably benign Het
Olfr531 T G 7: 140,400,900 S49R possibly damaging Het
P3h3 T A 6: 124,841,681 E731D probably damaging Het
Pcdhac2 A G 18: 37,146,474 R836G probably benign Het
Pdzd2 A G 15: 12,376,299 V1250A probably benign Het
Pgbd1 G A 13: 21,434,430 T19I possibly damaging Het
Phtf2 T A 5: 20,813,251 R31* probably null Het
Plod2 T A 9: 92,593,746 V294D probably benign Het
Rassf5 C T 1: 131,244,983 G50R probably damaging Het
Rexo5 A G 7: 119,845,383 T694A probably benign Het
Rtcb A C 10: 85,951,451 S82A probably damaging Het
Rufy4 T C 1: 74,132,883 L255P probably damaging Het
Slc35c1 A G 2: 92,454,514 F252L probably damaging Het
Slco6d1 A T 1: 98,499,747 probably benign Het
Sox10 T G 15: 79,163,285 probably benign Het
Stard9 A G 2: 120,698,547 M1762V probably benign Het
Stat3 A T 11: 100,908,083 Y94N probably damaging Het
Tecta T A 9: 42,345,634 Y1582F probably benign Het
Tex44 A G 1: 86,427,731 D454G probably damaging Het
Tle6 A G 10: 81,595,419 probably benign Het
Tmem57 C A 4: 134,828,217 C315F probably benign Het
Tmod2 T C 9: 75,576,759 E303G probably damaging Het
Trem1 A G 17: 48,237,217 D90G possibly damaging Het
Trhde A T 10: 114,448,324 D751E probably benign Het
Ttn A T 2: 76,965,245 probably null Het
Vars2 T C 17: 35,659,176 T774A probably benign Het
Wdr63 A G 3: 146,062,331 S592P probably benign Het
Other mutations in Mef2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01923:Mef2a APN 7 67264872 missense probably damaging 0.98
IGL02112:Mef2a APN 7 67264872 missense probably damaging 0.98
P0024:Mef2a UTSW 7 67295574 missense probably damaging 1.00
R0390:Mef2a UTSW 7 67251724 missense probably damaging 0.96
R0583:Mef2a UTSW 7 67235148 nonsense probably null
R0584:Mef2a UTSW 7 67235148 nonsense probably null
R0597:Mef2a UTSW 7 67235148 nonsense probably null
R0608:Mef2a UTSW 7 67235148 nonsense probably null
R0704:Mef2a UTSW 7 67235148 nonsense probably null
R1859:Mef2a UTSW 7 67266018 missense probably damaging 0.97
R2166:Mef2a UTSW 7 67266122 missense probably damaging 1.00
R2427:Mef2a UTSW 7 67266060 missense probably damaging 0.98
R3618:Mef2a UTSW 7 67268327 missense probably benign 0.34
R3619:Mef2a UTSW 7 67268327 missense probably benign 0.34
R4576:Mef2a UTSW 7 67240439 missense probably benign 0.00
R4577:Mef2a UTSW 7 67240439 missense probably benign 0.00
R4578:Mef2a UTSW 7 67240439 missense probably benign 0.00
R4635:Mef2a UTSW 7 67240427 missense possibly damaging 0.67
R5805:Mef2a UTSW 7 67251668 missense possibly damaging 0.89
X0011:Mef2a UTSW 7 67235164 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGAACCAGGAAGCCTTAGGTCAC -3'
(R):5'- TTAGGCCCTCAGTCTTCTCAGACAG -3'

Sequencing Primer
(F):5'- CCTCATGCGTTTTACAGAAGG -3'
(R):5'- CAGACAGTTTCCTGAGCTTTG -3'
Posted On2013-07-11