Incidental Mutation 'R7178:Cep250'
ID558745
Institutional Source Beutler Lab
Gene Symbol Cep250
Ensembl Gene ENSMUSG00000038241
Gene Namecentrosomal protein 250
SynonymsCep2, Inmp, B230210E21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7178 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location155956458-155998900 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 155973455 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 631 (L631*)
Ref Sequence ENSEMBL: ENSMUSP00000114426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039994] [ENSMUST00000094421] [ENSMUST00000109619] [ENSMUST00000124812] [ENSMUST00000151569]
Predicted Effect probably null
Transcript: ENSMUST00000039994
AA Change: L631*
SMART Domains Protein: ENSMUSP00000038255
Gene: ENSMUSG00000038241
AA Change: L631*

DomainStartEndE-ValueType
Pfam:Rootletin 38 215 4.2e-56 PFAM
low complexity region 228 241 N/A INTRINSIC
coiled coil region 248 327 N/A INTRINSIC
internal_repeat_1 444 460 1.47e-18 PROSPERO
internal_repeat_1 465 481 1.47e-18 PROSPERO
low complexity region 495 506 N/A INTRINSIC
low complexity region 557 580 N/A INTRINSIC
low complexity region 583 595 N/A INTRINSIC
low complexity region 635 650 N/A INTRINSIC
low complexity region 669 677 N/A INTRINSIC
low complexity region 688 703 N/A INTRINSIC
low complexity region 708 719 N/A INTRINSIC
low complexity region 896 914 N/A INTRINSIC
low complexity region 990 1007 N/A INTRINSIC
low complexity region 1043 1053 N/A INTRINSIC
low complexity region 1138 1143 N/A INTRINSIC
low complexity region 1182 1195 N/A INTRINSIC
coiled coil region 1257 1687 N/A INTRINSIC
low complexity region 1872 1895 N/A INTRINSIC
low complexity region 1919 1933 N/A INTRINSIC
low complexity region 1941 1960 N/A INTRINSIC
internal_repeat_2 2002 2052 3.9e-6 PROSPERO
coiled coil region 2068 2169 N/A INTRINSIC
coiled coil region 2196 2217 N/A INTRINSIC
coiled coil region 2251 2310 N/A INTRINSIC
low complexity region 2325 2338 N/A INTRINSIC
coiled coil region 2340 2366 N/A INTRINSIC
low complexity region 2379 2388 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000094421
AA Change: L611*
SMART Domains Protein: ENSMUSP00000091988
Gene: ENSMUSG00000038241
AA Change: L611*

DomainStartEndE-ValueType
Pfam:Rootletin 38 215 5.4e-56 PFAM
low complexity region 228 241 N/A INTRINSIC
coiled coil region 248 357 N/A INTRINSIC
coiled coil region 400 1165 N/A INTRINSIC
coiled coil region 1237 1667 N/A INTRINSIC
low complexity region 1852 1875 N/A INTRINSIC
low complexity region 1899 1913 N/A INTRINSIC
low complexity region 1921 1940 N/A INTRINSIC
internal_repeat_1 1982 2032 3.35e-6 PROSPERO
coiled coil region 2048 2149 N/A INTRINSIC
coiled coil region 2176 2197 N/A INTRINSIC
coiled coil region 2231 2290 N/A INTRINSIC
low complexity region 2305 2318 N/A INTRINSIC
coiled coil region 2320 2346 N/A INTRINSIC
low complexity region 2359 2368 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000109619
AA Change: L632*
SMART Domains Protein: ENSMUSP00000105248
Gene: ENSMUSG00000038241
AA Change: L632*

DomainStartEndE-ValueType
Pfam:Rootletin 38 214 4.1e-60 PFAM
low complexity region 215 225 N/A INTRINSIC
low complexity region 228 241 N/A INTRINSIC
coiled coil region 248 357 N/A INTRINSIC
internal_repeat_1 445 461 1.51e-18 PROSPERO
internal_repeat_1 466 482 1.51e-18 PROSPERO
low complexity region 496 507 N/A INTRINSIC
low complexity region 558 581 N/A INTRINSIC
low complexity region 584 596 N/A INTRINSIC
low complexity region 636 651 N/A INTRINSIC
low complexity region 670 678 N/A INTRINSIC
low complexity region 689 704 N/A INTRINSIC
low complexity region 709 720 N/A INTRINSIC
low complexity region 897 915 N/A INTRINSIC
low complexity region 991 1008 N/A INTRINSIC
low complexity region 1044 1054 N/A INTRINSIC
low complexity region 1139 1144 N/A INTRINSIC
low complexity region 1183 1196 N/A INTRINSIC
coiled coil region 1258 1688 N/A INTRINSIC
low complexity region 1873 1896 N/A INTRINSIC
low complexity region 1920 1934 N/A INTRINSIC
low complexity region 1942 1961 N/A INTRINSIC
internal_repeat_2 2003 2053 3.95e-6 PROSPERO
coiled coil region 2069 2170 N/A INTRINSIC
coiled coil region 2197 2218 N/A INTRINSIC
coiled coil region 2252 2311 N/A INTRINSIC
low complexity region 2326 2339 N/A INTRINSIC
coiled coil region 2341 2367 N/A INTRINSIC
low complexity region 2380 2389 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124812
Predicted Effect probably null
Transcript: ENSMUST00000151569
AA Change: L631*
SMART Domains Protein: ENSMUSP00000114426
Gene: ENSMUSG00000038241
AA Change: L631*

DomainStartEndE-ValueType
Pfam:Rootletin 38 215 1.3e-56 PFAM
low complexity region 228 241 N/A INTRINSIC
coiled coil region 248 327 N/A INTRINSIC
internal_repeat_1 444 460 1.16e-14 PROSPERO
internal_repeat_1 465 481 1.16e-14 PROSPERO
low complexity region 495 506 N/A INTRINSIC
low complexity region 557 580 N/A INTRINSIC
low complexity region 583 595 N/A INTRINSIC
low complexity region 635 650 N/A INTRINSIC
low complexity region 669 677 N/A INTRINSIC
low complexity region 688 703 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a core centrosomal protein required for centriole-centriole cohesion during interphase of the cell cycle. The encoded protein dissociates from the centrosomes when parental centrioles separate at the beginning of mitosis. The protein associates with and is phosphorylated by NIMA-related kinase 2, which is also associated with the centrosome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsbg1 A G 9: 54,628,461 I130T possibly damaging Het
Adam24 T A 8: 40,680,000 L169* probably null Het
Als2 A T 1: 59,207,812 I556N probably damaging Het
Ankrd44 A T 1: 54,649,440 N212K Het
Anpep T C 7: 79,840,988 D260G probably benign Het
Arhgap17 A T 7: 123,285,358 probably null Het
Atad2 C T 15: 58,117,293 R383Q probably damaging Het
Atp11b T A 3: 35,819,950 M696K probably benign Het
Atp13a2 A G 4: 140,999,151 T350A probably damaging Het
Atp8b2 T C 3: 89,943,672 D29G possibly damaging Het
Baz2a C T 10: 128,124,457 R1514W probably damaging Het
Clec4a3 T C 6: 122,964,292 I82T probably benign Het
Csmd3 T A 15: 47,590,774 I2648F Het
Cul5 A G 9: 53,644,526 F247L probably benign Het
D430042O09Rik T C 7: 125,866,327 V1317A probably benign Het
Dnajc24 A T 2: 105,970,462 M101K probably damaging Het
Dnhd1 T A 7: 105,694,993 V1848E probably damaging Het
Dspp A G 5: 104,174,066 T14A probably benign Het
Fam166a G A 2: 25,220,240 V55I probably damaging Het
Fam196b G T 11: 34,402,359 V134F probably damaging Het
Gm7298 T G 6: 121,785,896 I1392S probably damaging Het
Gm9955 A T 18: 24,709,163 S62R unknown Het
Gtsf1 T G 15: 103,419,961 N130T probably benign Het
Heatr5a C A 12: 51,925,142 S755I probably damaging Het
Hrc A G 7: 45,336,261 T279A possibly damaging Het
Hvcn1 T C 5: 122,233,510 W38R probably damaging Het
Hyal6 A G 6: 24,734,835 S256G probably benign Het
Ipo13 A G 4: 117,903,884 S546P possibly damaging Het
Kif24 A G 4: 41,395,085 V730A probably benign Het
L3mbtl2 T C 15: 81,671,074 V176A probably benign Het
Lgi1 T C 19: 38,306,285 Y502H probably damaging Het
Liph T A 16: 21,976,328 D178V probably damaging Het
Maea T C 5: 33,358,510 V47A probably damaging Het
Mak16 A C 8: 31,166,574 S42A probably benign Het
Mamdc4 T C 2: 25,568,965 I269V probably benign Het
Mapk8ip3 A T 17: 24,901,754 M812K probably benign Het
Muc4 T A 16: 32,752,788 S889T unknown Het
Npy6r A G 18: 44,276,484 N324S probably damaging Het
Ntrk3 T G 7: 78,356,147 T489P possibly damaging Het
Olfr1102 G A 2: 87,002,535 V189I probably benign Het
Olfr187 T A 16: 59,035,933 D268V probably benign Het
Olfr69 G A 7: 103,767,975 Q141* probably null Het
Otof G C 5: 30,383,534 T887S possibly damaging Het
Papola T C 12: 105,807,184 V154A probably damaging Het
Pde4dip T C 3: 97,715,630 H1421R probably benign Het
Plpp5 T C 8: 25,720,579 S66P probably benign Het
Ppp6r3 T A 19: 3,518,337 I154L probably benign Het
Prr18 A C 17: 8,341,909 D299A possibly damaging Het
Psmb1 G A 17: 15,477,259 S198F possibly damaging Het
Qars T C 9: 108,515,123 V723A possibly damaging Het
Rab6a A T 7: 100,636,752 R185* probably null Het
Scn2a C T 2: 65,748,853 Q1511* probably null Het
Serpinb3d T A 1: 107,080,776 I120F possibly damaging Het
Serpini2 T C 3: 75,258,148 T175A probably damaging Het
Skiv2l T C 17: 34,839,464 T1226A probably benign Het
Slc17a6 A G 7: 51,667,511 I427V possibly damaging Het
Slc2a2 C T 3: 28,719,482 A312V possibly damaging Het
Snx33 C T 9: 56,925,867 R306H probably damaging Het
Spcs1 G A 14: 31,000,481 S127F possibly damaging Het
Speg T C 1: 75,422,383 V2158A possibly damaging Het
Sptbn4 T A 7: 27,418,056 I423F probably damaging Het
Synj2 T A 17: 6,026,479 I930N possibly damaging Het
Tas2r140 T A 6: 133,055,660 D45V probably damaging Het
Tcf3 C A 10: 80,421,599 V11F unknown Het
Tead1 A T 7: 112,841,937 Q91L probably benign Het
Tgm5 T A 2: 121,085,768 probably benign Het
Tgoln1 C T 6: 72,616,045 G151S probably benign Het
Tnfrsf11a C A 1: 105,827,539 N445K probably benign Het
Ttn G C 2: 76,710,170 F34157L probably benign Het
Vmn2r91 C A 17: 18,136,162 P697Q probably damaging Het
Zeb2 G A 2: 44,996,994 L684F probably damaging Het
Zfp661 T C 2: 127,577,536 D228G probably benign Het
Zfp738 T C 13: 67,673,028 K77E probably damaging Het
Zkscan1 T A 5: 138,100,930 D378E probably damaging Het
Zswim9 T A 7: 13,259,997 D744V possibly damaging Het
Other mutations in Cep250
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Cep250 APN 2 155991329 missense probably benign 0.00
IGL01077:Cep250 APN 2 155962134 missense probably damaging 1.00
IGL01084:Cep250 APN 2 155998393 missense probably benign 0.00
IGL01400:Cep250 APN 2 155998291 missense possibly damaging 0.78
IGL01570:Cep250 APN 2 155967663 splice site probably benign
IGL01583:Cep250 APN 2 155976149 missense probably damaging 0.99
IGL01590:Cep250 APN 2 155992317 missense possibly damaging 0.80
IGL01647:Cep250 APN 2 155983376 missense probably benign 0.02
IGL01959:Cep250 APN 2 155983359 missense possibly damaging 0.63
IGL02066:Cep250 APN 2 155976521 missense probably damaging 1.00
IGL02219:Cep250 APN 2 155991594 missense probably benign 0.26
IGL02322:Cep250 APN 2 155990328 missense probably damaging 1.00
IGL02728:Cep250 APN 2 155983278 unclassified probably benign
IGL02955:Cep250 APN 2 155975756 missense probably benign 0.01
IGL03369:Cep250 APN 2 155990271 missense probably benign 0.00
R0366:Cep250 UTSW 2 155988401 missense probably benign 0.00
R0403:Cep250 UTSW 2 155992349 missense probably damaging 0.99
R0441:Cep250 UTSW 2 155972004 missense possibly damaging 0.82
R0482:Cep250 UTSW 2 155964974 splice site probably benign
R0507:Cep250 UTSW 2 155992532 missense possibly damaging 0.60
R0614:Cep250 UTSW 2 155970097 nonsense probably null
R0855:Cep250 UTSW 2 155964111 missense probably damaging 1.00
R0973:Cep250 UTSW 2 155964289 splice site probably benign
R1137:Cep250 UTSW 2 155990840 missense probably benign 0.05
R1270:Cep250 UTSW 2 155990681 missense probably benign 0.01
R1313:Cep250 UTSW 2 155972079 missense probably damaging 0.98
R1313:Cep250 UTSW 2 155972079 missense probably damaging 0.98
R1470:Cep250 UTSW 2 155991075 missense probably damaging 0.99
R1470:Cep250 UTSW 2 155991075 missense probably damaging 0.99
R1703:Cep250 UTSW 2 155965546 missense probably benign 0.23
R1705:Cep250 UTSW 2 155963786 missense probably damaging 1.00
R1740:Cep250 UTSW 2 155973356 missense probably damaging 0.99
R1796:Cep250 UTSW 2 155992187 missense possibly damaging 0.88
R1897:Cep250 UTSW 2 155976095 missense probably damaging 1.00
R1900:Cep250 UTSW 2 155985374 critical splice donor site probably null
R1958:Cep250 UTSW 2 155976381 splice site probably null
R1974:Cep250 UTSW 2 155989504 missense probably damaging 0.96
R2015:Cep250 UTSW 2 155981453 missense probably damaging 0.96
R2033:Cep250 UTSW 2 155970892 missense probably damaging 0.99
R2224:Cep250 UTSW 2 155991817 missense possibly damaging 0.94
R2266:Cep250 UTSW 2 155976170 missense probably benign 0.13
R2278:Cep250 UTSW 2 155992632 missense probably damaging 1.00
R2332:Cep250 UTSW 2 155990607 missense probably damaging 1.00
R2364:Cep250 UTSW 2 155992632 missense probably damaging 1.00
R2366:Cep250 UTSW 2 155992632 missense probably damaging 1.00
R2367:Cep250 UTSW 2 155992632 missense probably damaging 1.00
R2385:Cep250 UTSW 2 155974341 missense probably damaging 1.00
R2830:Cep250 UTSW 2 155983316 missense probably benign 0.00
R2895:Cep250 UTSW 2 155992122 missense probably benign 0.00
R2965:Cep250 UTSW 2 155994878 missense probably benign 0.44
R2966:Cep250 UTSW 2 155994878 missense probably benign 0.44
R3016:Cep250 UTSW 2 155991288 missense probably damaging 1.00
R3052:Cep250 UTSW 2 155991048 missense probably damaging 0.99
R3424:Cep250 UTSW 2 155981461 missense probably benign 0.02
R3930:Cep250 UTSW 2 155992632 missense probably damaging 1.00
R4085:Cep250 UTSW 2 155992632 missense probably damaging 1.00
R4087:Cep250 UTSW 2 155992632 missense probably damaging 1.00
R4088:Cep250 UTSW 2 155992632 missense probably damaging 1.00
R4090:Cep250 UTSW 2 155992632 missense probably damaging 1.00
R4110:Cep250 UTSW 2 155992632 missense probably damaging 1.00
R4355:Cep250 UTSW 2 155991525 missense probably damaging 1.00
R4601:Cep250 UTSW 2 155962053 missense probably benign 0.10
R4721:Cep250 UTSW 2 155970199 missense probably damaging 1.00
R4995:Cep250 UTSW 2 155988316 missense probably damaging 1.00
R5053:Cep250 UTSW 2 155962928 missense possibly damaging 0.77
R5090:Cep250 UTSW 2 155976404 missense probably damaging 1.00
R5744:Cep250 UTSW 2 155981474 missense possibly damaging 0.60
R5775:Cep250 UTSW 2 155969374 missense possibly damaging 0.92
R5986:Cep250 UTSW 2 155979277 missense probably damaging 1.00
R6112:Cep250 UTSW 2 155994583 missense possibly damaging 0.95
R6152:Cep250 UTSW 2 155981438 missense possibly damaging 0.94
R6823:Cep250 UTSW 2 155981459 missense probably benign 0.02
R6859:Cep250 UTSW 2 155992526 missense probably benign 0.24
R6900:Cep250 UTSW 2 155996270 critical splice acceptor site probably null
R7107:Cep250 UTSW 2 155995394 missense probably benign 0.00
R7131:Cep250 UTSW 2 155965077 missense probably damaging 1.00
R7241:Cep250 UTSW 2 155991552 missense probably benign 0.20
R7264:Cep250 UTSW 2 155979151 missense probably damaging 0.99
R7290:Cep250 UTSW 2 155992762 missense probably benign 0.03
X0061:Cep250 UTSW 2 155961985 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GTTTCTGTGCTGTGACCACC -3'
(R):5'- GGGGATTTACAGTGCTTAAGGC -3'

Sequencing Primer
(F):5'- GTGACCACCTGTCTCATGAATGAATG -3'
(R):5'- GGGATTTACAGTGCTTAAGGCTAATC -3'
Posted On2019-06-26