Incidental Mutation 'R7178:Slc17a6'
ID558767
Institutional Source Beutler Lab
Gene Symbol Slc17a6
Ensembl Gene ENSMUSG00000030500
Gene Namesolute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 6
Synonyms2900073D12Rik, VGLUT2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7178 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location51622006-51671119 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 51667511 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 427 (I427V)
Ref Sequence ENSEMBL: ENSMUSP00000032710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032710] [ENSMUST00000207945]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032710
AA Change: I427V

PolyPhen 2 Score 0.584 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000032710
Gene: ENSMUSG00000030500
AA Change: I427V

DomainStartEndE-ValueType
Pfam:MFS_1 76 461 6.5e-50 PFAM
transmembrane domain 476 498 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207945
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (75/75)
MGI Phenotype PHENOTYPE: Mice homozygous for null mutations display neonatal lethality, respiratory failure, and abnormal nervous system physiology. Heterozygous mice for one allele display abnormal miniature EPSC and reduced responses to neuropathic pain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsbg1 A G 9: 54,628,461 I130T possibly damaging Het
Adam24 T A 8: 40,680,000 L169* probably null Het
Als2 A T 1: 59,207,812 I556N probably damaging Het
Ankrd44 A T 1: 54,649,440 N212K Het
Anpep T C 7: 79,840,988 D260G probably benign Het
Arhgap17 A T 7: 123,285,358 probably null Het
Atad2 C T 15: 58,117,293 R383Q probably damaging Het
Atp11b T A 3: 35,819,950 M696K probably benign Het
Atp13a2 A G 4: 140,999,151 T350A probably damaging Het
Atp8b2 T C 3: 89,943,672 D29G possibly damaging Het
Baz2a C T 10: 128,124,457 R1514W probably damaging Het
Cep250 T A 2: 155,973,455 L631* probably null Het
Clec4a3 T C 6: 122,964,292 I82T probably benign Het
Csmd3 T A 15: 47,590,774 I2648F Het
Cul5 A G 9: 53,644,526 F247L probably benign Het
D430042O09Rik T C 7: 125,866,327 V1317A probably benign Het
Dnajc24 A T 2: 105,970,462 M101K probably damaging Het
Dnhd1 T A 7: 105,694,993 V1848E probably damaging Het
Dspp A G 5: 104,174,066 T14A probably benign Het
Fam166a G A 2: 25,220,240 V55I probably damaging Het
Fam196b G T 11: 34,402,359 V134F probably damaging Het
Gm7298 T G 6: 121,785,896 I1392S probably damaging Het
Gm9955 A T 18: 24,709,163 S62R unknown Het
Gtsf1 T G 15: 103,419,961 N130T probably benign Het
Heatr5a C A 12: 51,925,142 S755I probably damaging Het
Hrc A G 7: 45,336,261 T279A possibly damaging Het
Hvcn1 T C 5: 122,233,510 W38R probably damaging Het
Hyal6 A G 6: 24,734,835 S256G probably benign Het
Ipo13 A G 4: 117,903,884 S546P possibly damaging Het
Kif24 A G 4: 41,395,085 V730A probably benign Het
L3mbtl2 T C 15: 81,671,074 V176A probably benign Het
Lgi1 T C 19: 38,306,285 Y502H probably damaging Het
Liph T A 16: 21,976,328 D178V probably damaging Het
Maea T C 5: 33,358,510 V47A probably damaging Het
Mak16 A C 8: 31,166,574 S42A probably benign Het
Mamdc4 T C 2: 25,568,965 I269V probably benign Het
Mapk8ip3 A T 17: 24,901,754 M812K probably benign Het
Muc4 T A 16: 32,752,788 S889T unknown Het
Npy6r A G 18: 44,276,484 N324S probably damaging Het
Ntrk3 T G 7: 78,356,147 T489P possibly damaging Het
Olfr1102 G A 2: 87,002,535 V189I probably benign Het
Olfr187 T A 16: 59,035,933 D268V probably benign Het
Olfr69 G A 7: 103,767,975 Q141* probably null Het
Otof G C 5: 30,383,534 T887S possibly damaging Het
Papola T C 12: 105,807,184 V154A probably damaging Het
Pde4dip T C 3: 97,715,630 H1421R probably benign Het
Plpp5 T C 8: 25,720,579 S66P probably benign Het
Ppp6r3 T A 19: 3,518,337 I154L probably benign Het
Prr18 A C 17: 8,341,909 D299A possibly damaging Het
Psmb1 G A 17: 15,477,259 S198F possibly damaging Het
Qars T C 9: 108,515,123 V723A possibly damaging Het
Rab6a A T 7: 100,636,752 R185* probably null Het
Scn2a C T 2: 65,748,853 Q1511* probably null Het
Serpinb3d T A 1: 107,080,776 I120F possibly damaging Het
Serpini2 T C 3: 75,258,148 T175A probably damaging Het
Skiv2l T C 17: 34,839,464 T1226A probably benign Het
Slc2a2 C T 3: 28,719,482 A312V possibly damaging Het
Snx33 C T 9: 56,925,867 R306H probably damaging Het
Spcs1 G A 14: 31,000,481 S127F possibly damaging Het
Speg T C 1: 75,422,383 V2158A possibly damaging Het
Sptbn4 T A 7: 27,418,056 I423F probably damaging Het
Synj2 T A 17: 6,026,479 I930N possibly damaging Het
Tas2r140 T A 6: 133,055,660 D45V probably damaging Het
Tcf3 C A 10: 80,421,599 V11F unknown Het
Tead1 A T 7: 112,841,937 Q91L probably benign Het
Tgm5 T A 2: 121,085,768 probably benign Het
Tgoln1 C T 6: 72,616,045 G151S probably benign Het
Tnfrsf11a C A 1: 105,827,539 N445K probably benign Het
Ttn G C 2: 76,710,170 F34157L probably benign Het
Vmn2r91 C A 17: 18,136,162 P697Q probably damaging Het
Zeb2 G A 2: 44,996,994 L684F probably damaging Het
Zfp661 T C 2: 127,577,536 D228G probably benign Het
Zfp738 T C 13: 67,673,028 K77E probably damaging Het
Zkscan1 T A 5: 138,100,930 D378E probably damaging Het
Zswim9 T A 7: 13,259,997 D744V possibly damaging Het
Other mutations in Slc17a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01408:Slc17a6 APN 7 51669115 missense probably benign 0.15
IGL01653:Slc17a6 APN 7 51668022 missense possibly damaging 0.92
IGL01993:Slc17a6 APN 7 51667957 missense possibly damaging 0.51
IGL02082:Slc17a6 APN 7 51669029 missense probably benign 0.00
IGL02212:Slc17a6 APN 7 51667470 missense possibly damaging 0.94
IGL02544:Slc17a6 APN 7 51666155 nonsense probably null
IGL02585:Slc17a6 APN 7 51625349 missense probably benign 0.00
IGL03206:Slc17a6 APN 7 51666023 splice site probably benign
IGL03396:Slc17a6 APN 7 51669092 missense probably damaging 1.00
R0137:Slc17a6 UTSW 7 51666144 missense probably benign 0.00
R0141:Slc17a6 UTSW 7 51669067 missense probably benign 0.10
R0207:Slc17a6 UTSW 7 51646180 intron probably benign
R0362:Slc17a6 UTSW 7 51658771 missense probably damaging 1.00
R0841:Slc17a6 UTSW 7 51625315 missense probably benign 0.29
R1037:Slc17a6 UTSW 7 51649248 splice site probably benign
R1325:Slc17a6 UTSW 7 51661552 missense probably benign 0.15
R1614:Slc17a6 UTSW 7 51646277 intron probably benign
R1625:Slc17a6 UTSW 7 51661460 missense probably benign 0.00
R1736:Slc17a6 UTSW 7 51661585 splice site probably benign
R1777:Slc17a6 UTSW 7 51646209 missense possibly damaging 0.63
R1824:Slc17a6 UTSW 7 51661546 missense probably damaging 1.00
R2249:Slc17a6 UTSW 7 51667906 missense probably damaging 1.00
R4283:Slc17a6 UTSW 7 51645076 missense probably damaging 1.00
R4910:Slc17a6 UTSW 7 51658741 missense possibly damaging 0.78
R5301:Slc17a6 UTSW 7 51658771 missense probably damaging 1.00
R5523:Slc17a6 UTSW 7 51626850 nonsense probably null
R5570:Slc17a6 UTSW 7 51658756 missense probably benign 0.00
R5720:Slc17a6 UTSW 7 51625397 missense probably damaging 1.00
R5736:Slc17a6 UTSW 7 51645093 missense possibly damaging 0.78
R5765:Slc17a6 UTSW 7 51625501 missense possibly damaging 0.93
R6380:Slc17a6 UTSW 7 51667463 missense probably benign 0.02
R6989:Slc17a6 UTSW 7 51661476 missense possibly damaging 0.88
R7194:Slc17a6 UTSW 7 51626892 missense probably damaging 1.00
R7325:Slc17a6 UTSW 7 51645018 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GGCCCAATAATGGTTGTTAATCAC -3'
(R):5'- AGGACAGGGTGTGCATTGTC -3'

Sequencing Primer
(F):5'- AAGTTGACCATGCTCCAGTG -3'
(R):5'- CATTCTCTTAACAAATGGATCGGG -3'
Posted On2019-06-26