Incidental Mutation 'R7179:Col25a1'
ID558825
Institutional Source Beutler Lab
Gene Symbol Col25a1
Ensembl Gene ENSMUSG00000058897
Gene Namecollagen, type XXV, alpha 1
Synonyms2700062B08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R7179 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location130131501-130599877 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 130530119 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 321 (R321L)
Ref Sequence ENSEMBL: ENSMUSP00000079210 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080335] [ENSMUST00000106353] [ENSMUST00000183368]
Predicted Effect probably damaging
Transcript: ENSMUST00000080335
AA Change: R321L

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000079210
Gene: ENSMUSG00000058897
AA Change: R321L

DomainStartEndE-ValueType
low complexity region 35 47 N/A INTRINSIC
Pfam:Collagen 119 165 7e-9 PFAM
low complexity region 188 246 N/A INTRINSIC
low complexity region 275 288 N/A INTRINSIC
Pfam:Collagen 311 374 5.4e-11 PFAM
Pfam:Collagen 368 427 2e-9 PFAM
Pfam:Collagen 447 504 1.6e-10 PFAM
Pfam:Collagen 494 561 3.3e-8 PFAM
Pfam:Collagen 586 660 4.3e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106353
AA Change: R308L

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000101960
Gene: ENSMUSG00000058897
AA Change: R308L

DomainStartEndE-ValueType
low complexity region 35 47 N/A INTRINSIC
Pfam:Collagen 119 174 1.7e-11 PFAM
Pfam:Collagen 183 244 6.2e-12 PFAM
Pfam:Collagen 233 297 7.5e-11 PFAM
Pfam:Collagen 294 345 1.8e-9 PFAM
Pfam:Collagen 343 399 1.1e-10 PFAM
Pfam:Collagen 419 475 1.9e-10 PFAM
low complexity region 490 525 N/A INTRINSIC
Pfam:Collagen 555 622 6e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000183368
AA Change: R321L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138875
Gene: ENSMUSG00000058897
AA Change: R321L

DomainStartEndE-ValueType
low complexity region 35 47 N/A INTRINSIC
Pfam:Collagen 119 165 6.8e-9 PFAM
low complexity region 188 246 N/A INTRINSIC
internal_repeat_2 249 294 2.8e-5 PROSPERO
internal_repeat_1 294 308 4.06e-8 PROSPERO
Pfam:Collagen 309 372 2.1e-11 PFAM
Pfam:Collagen 371 427 3.7e-10 PFAM
Pfam:Collagen 447 496 7.7e-10 PFAM
low complexity region 497 506 N/A INTRINSIC
low complexity region 514 527 N/A INTRINSIC
low complexity region 556 571 N/A INTRINSIC
Meta Mutation Damage Score 0.13 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency 100% (76/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a brain-specific membrane associated collagen. A product of proteolytic processing of the encoded protein, CLAC (collagenous Alzheimer amyloid plaque component), binds to amyloid beta-peptides found in Alzheimer amyloid plaques but CLAC inhibits rather than facilitates amyloid fibril elongation (PMID: 16300410). A study of over-expression of this collagen in mice, however, found changes in pathology and behavior suggesting that the encoded protein may promote amyloid plaque formation (PMID: 19548013). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality, cyanosis and abnormal body curvature with apoptosis of phrenic nerve motor neurons and failure of diaphragm innervation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot13 A T 13: 24,818,171 I96K probably benign Het
Adam6a A G 12: 113,545,671 T555A probably benign Het
Alms1 C T 6: 85,621,369 P1059L probably benign Het
Apol7c T C 15: 77,525,643 T368A probably benign Het
Arfgef3 A T 10: 18,599,267 L1557Q probably damaging Het
Baz2a C T 10: 128,124,457 R1514W probably damaging Het
Bmp3 T A 5: 98,872,763 D348E probably damaging Het
Bves A G 10: 45,354,817 S295G probably damaging Het
Carmil1 A G 13: 24,020,069 C1328R probably benign Het
Ccnk T A 12: 108,187,258 Y93N probably damaging Het
Ccr1 A T 9: 123,964,052 V147D probably damaging Het
Cd24a G A 10: 43,582,640 G36S probably benign Het
Cep104 A G 4: 153,992,867 Y569C probably damaging Het
Chd2 A T 7: 73,475,420 I884N probably damaging Het
Cnst A T 1: 179,579,382 probably benign Het
Col22a1 A G 15: 71,933,413 L146P unknown Het
Ctnnd2 T C 15: 30,683,364 Y504H possibly damaging Het
D3Ertd751e C A 3: 41,748,708 Q73K probably damaging Het
Dsc2 C T 18: 20,035,275 probably null Het
Eya1 A T 1: 14,302,852 S14R probably damaging Het
Fam131c A T 4: 141,383,017 probably null Het
Fam71a G A 1: 191,164,021 R142C probably damaging Het
Flvcr2 T C 12: 85,747,191 F114L possibly damaging Het
Fyn A G 10: 39,532,124 D321G possibly damaging Het
Galnt5 A C 2: 57,998,609 M74L probably benign Het
Gas2l2 G A 11: 83,422,462 P675S probably benign Het
Gm9508 G T 10: 77,696,636 Q200K unknown Het
Greb1l G A 18: 10,544,576 S1390N probably benign Het
Hdac5 G T 11: 102,204,559 T430K possibly damaging Het
Hjurp TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTGCT TCT 1: 88,266,278 probably benign Het
Khnyn C T 14: 55,894,354 P578S probably damaging Het
Lepr A T 4: 101,745,659 T215S probably benign Het
Lrfn5 G A 12: 61,843,982 V686I probably benign Het
Mapkap1 T A 2: 34,518,700 H233Q possibly damaging Het
Mcm3 A G 1: 20,814,857 I201T probably damaging Het
Metrnl G A 11: 121,715,908 R263Q probably damaging Het
Mettl22 A G 16: 8,478,060 E71G probably benign Het
Muc16 T C 9: 18,642,008 T4330A probably benign Het
Mug1 A G 6: 121,857,420 T387A probably benign Het
Myh4 A G 11: 67,244,724 D379G probably benign Het
Nbas A G 12: 13,405,397 D1204G possibly damaging Het
Ncor2 T C 5: 125,055,783 K478E unknown Het
Olfr173 T A 16: 58,796,887 I320F probably benign Het
Olfr294 A T 7: 86,616,366 L93Q possibly damaging Het
Olfr557 A G 7: 102,698,270 T11A probably benign Het
Osbpl7 G A 11: 97,050,836 V62I probably benign Het
Pak1ip1 A G 13: 41,009,542 N246S probably damaging Het
Prim1 A G 10: 128,015,976 Y39C probably damaging Het
Prl3b1 G T 13: 27,243,844 V46L probably benign Het
Prss54 A T 8: 95,565,571 S127T probably benign Het
Rasal3 G A 17: 32,392,417 T912M probably damaging Het
Rrp12 T A 19: 41,883,778 T420S probably benign Het
Rspo1 A G 4: 125,005,038 N51D probably damaging Het
Rufy4 A G 1: 74,132,876 R253G probably benign Het
Scaf1 G A 7: 45,007,743 R571C unknown Het
Scn2a A T 2: 65,701,979 H645L probably damaging Het
Sec24b A G 3: 129,988,946 S1132P probably damaging Het
Slc1a2 A G 2: 102,755,945 K298R probably damaging Het
Slc25a54 T A 3: 109,107,257 N230K probably benign Het
Slc27a4 T G 2: 29,815,652 Y617* probably null Het
Slc2a10 T C 2: 165,515,349 S310P probably damaging Het
Snx33 C T 9: 56,925,867 R306H probably damaging Het
Spag9 A T 11: 94,089,432 probably null Het
Spg11 A T 2: 122,101,789 probably null Het
Sycp2l A G 13: 41,129,782 T165A probably damaging Het
Syt14 A G 1: 192,933,263 C189R probably damaging Het
Taar9 A T 10: 24,108,984 L184Q probably damaging Het
Tkt C T 14: 30,559,858 P111L probably damaging Het
Trpc1 A T 9: 95,721,144 L445Q possibly damaging Het
Usp53 A G 3: 122,949,710 S526P probably benign Het
Vps54 T G 11: 21,298,791 W447G probably damaging Het
Xirp2 A T 2: 67,509,833 H806L probably benign Het
Zfp451 A T 1: 33,802,570 H410Q unknown Het
Zfp688 A G 7: 127,419,312 C214R probably damaging Het
Zic4 A G 9: 91,379,121 D143G possibly damaging Het
Other mutations in Col25a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Col25a1 APN 3 130181784 splice site probably benign
IGL00570:Col25a1 APN 3 130546432 splice site probably benign
IGL01651:Col25a1 APN 3 130566485 missense probably benign 0.06
IGL02033:Col25a1 APN 3 130388948 splice site probably benign
IGL02117:Col25a1 APN 3 130519773 splice site probably benign
IGL02290:Col25a1 APN 3 130519811 splice site probably benign
IGL03135:Col25a1 APN 3 130529683 splice site probably benign
R0526:Col25a1 UTSW 3 130476394 missense probably damaging 1.00
R0602:Col25a1 UTSW 3 130575414 splice site probably null
R0670:Col25a1 UTSW 3 130386895 missense possibly damaging 0.95
R0830:Col25a1 UTSW 3 130584726 missense probably damaging 1.00
R1220:Col25a1 UTSW 3 130388925 splice site probably benign
R1623:Col25a1 UTSW 3 130550050 missense probably damaging 1.00
R1818:Col25a1 UTSW 3 130585737 critical splice donor site probably null
R2142:Col25a1 UTSW 3 130570316 missense probably damaging 1.00
R2190:Col25a1 UTSW 3 130584715 missense probably damaging 1.00
R2901:Col25a1 UTSW 3 130546391 missense probably damaging 1.00
R2902:Col25a1 UTSW 3 130546391 missense probably damaging 1.00
R3703:Col25a1 UTSW 3 130550033 splice site probably null
R3818:Col25a1 UTSW 3 130550071 missense possibly damaging 0.88
R4726:Col25a1 UTSW 3 130519781 missense possibly damaging 0.92
R4775:Col25a1 UTSW 3 130182819 missense possibly damaging 0.96
R5036:Col25a1 UTSW 3 130583329 splice site probably null
R5110:Col25a1 UTSW 3 130584725 makesense probably null
R5501:Col25a1 UTSW 3 130595663 missense probably benign 0.07
R5686:Col25a1 UTSW 3 130564154 missense probably damaging 1.00
R5698:Col25a1 UTSW 3 130478983 critical splice acceptor site probably null
R6131:Col25a1 UTSW 3 130535465 missense probably damaging 1.00
R6142:Col25a1 UTSW 3 130583329 splice site probably benign
R6549:Col25a1 UTSW 3 130182795 missense probably benign
R6624:Col25a1 UTSW 3 130566451 splice site probably null
R6898:Col25a1 UTSW 3 130584728 critical splice donor site probably null
R7030:Col25a1 UTSW 3 130479022 critical splice donor site probably null
R7114:Col25a1 UTSW 3 130595675 missense probably benign 0.06
R7172:Col25a1 UTSW 3 130570332 nonsense probably null
R7488:Col25a1 UTSW 3 130584701 missense probably damaging 1.00
X0028:Col25a1 UTSW 3 130577318 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- GGTTTCCAAGTGCCAAGCAAG -3'
(R):5'- TTCATACTTGGCTATGCTTGGC -3'

Sequencing Primer
(F):5'- CACGGCAATTTCCATATGCGTAG -3'
(R):5'- AACTGCACCATTGTGCA -3'
Posted On2019-06-26