Incidental Mutation 'R7179:Ccr1'
ID558843
Institutional Source Beutler Lab
Gene Symbol Ccr1
Ensembl Gene ENSMUSG00000025804
Gene Namechemokine (C-C motif) receptor 1
SynonymsCmkbr1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.133) question?
Stock #R7179 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location123962124-123968692 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 123964052 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 147 (V147D)
Ref Sequence ENSEMBL: ENSMUSP00000026911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026911]
Predicted Effect probably damaging
Transcript: ENSMUST00000026911
AA Change: V147D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000026911
Gene: ENSMUSG00000025804
AA Change: V147D

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 45 316 5.1e-8 PFAM
Pfam:7tm_1 51 301 8.5e-52 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency 100% (76/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the beta chemokine receptor family, which is predicted to be a seven transmembrane protein similar to G protein-coupled receptors. The ligands of this receptor include macrophage inflammatory protein 1 alpha (MIP-1 alpha), regulated on activation normal T expressed and secreted protein (RANTES), monocyte chemoattractant protein 3 (MCP-3), and myeloid progenitor inhibitory factor-1 (MPIF-1). Chemokines and their receptors mediated signal transduction are critical for the recruitment of effector immune cells to the site of inflammation. Knockout studies of the mouse homolog suggested the roles of this gene in host protection from inflammatory response, and susceptibility to virus and parasite. This gene and other chemokine receptor genes, including CCR2, CCRL2, CCR3, CCR5 and CCXCR1, are found to form a gene cluster on chromosome 3p. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit altered trafficking and proliferation of myeloid progenitor cells, and impairments in granulomatous inflammation of the lung and neutrophil associated host defense. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot13 A T 13: 24,818,171 I96K probably benign Het
Adam6a A G 12: 113,545,671 T555A probably benign Het
Alms1 C T 6: 85,621,369 P1059L probably benign Het
Apol7c T C 15: 77,525,643 T368A probably benign Het
Arfgef3 A T 10: 18,599,267 L1557Q probably damaging Het
Baz2a C T 10: 128,124,457 R1514W probably damaging Het
Bmp3 T A 5: 98,872,763 D348E probably damaging Het
Bves A G 10: 45,354,817 S295G probably damaging Het
Carmil1 A G 13: 24,020,069 C1328R probably benign Het
Ccnk T A 12: 108,187,258 Y93N probably damaging Het
Cd24a G A 10: 43,582,640 G36S probably benign Het
Cep104 A G 4: 153,992,867 Y569C probably damaging Het
Chd2 A T 7: 73,475,420 I884N probably damaging Het
Cnst A T 1: 179,579,382 probably benign Het
Col22a1 A G 15: 71,933,413 L146P unknown Het
Col25a1 G T 3: 130,530,119 R321L probably damaging Het
Ctnnd2 T C 15: 30,683,364 Y504H possibly damaging Het
D3Ertd751e C A 3: 41,748,708 Q73K probably damaging Het
Dsc2 C T 18: 20,035,275 probably null Het
Eya1 A T 1: 14,302,852 S14R probably damaging Het
Fam131c A T 4: 141,383,017 probably null Het
Fam71a G A 1: 191,164,021 R142C probably damaging Het
Flvcr2 T C 12: 85,747,191 F114L possibly damaging Het
Fyn A G 10: 39,532,124 D321G possibly damaging Het
Galnt5 A C 2: 57,998,609 M74L probably benign Het
Gas2l2 G A 11: 83,422,462 P675S probably benign Het
Gm9508 G T 10: 77,696,636 Q200K unknown Het
Greb1l G A 18: 10,544,576 S1390N probably benign Het
Hdac5 G T 11: 102,204,559 T430K possibly damaging Het
Hjurp TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTGCT TCT 1: 88,266,278 probably benign Het
Khnyn C T 14: 55,894,354 P578S probably damaging Het
Lepr A T 4: 101,745,659 T215S probably benign Het
Lrfn5 G A 12: 61,843,982 V686I probably benign Het
Mapkap1 T A 2: 34,518,700 H233Q possibly damaging Het
Mcm3 A G 1: 20,814,857 I201T probably damaging Het
Metrnl G A 11: 121,715,908 R263Q probably damaging Het
Mettl22 A G 16: 8,478,060 E71G probably benign Het
Muc16 T C 9: 18,642,008 T4330A probably benign Het
Mug1 A G 6: 121,857,420 T387A probably benign Het
Myh4 A G 11: 67,244,724 D379G probably benign Het
Nbas A G 12: 13,405,397 D1204G possibly damaging Het
Ncor2 T C 5: 125,055,783 K478E unknown Het
Olfr173 T A 16: 58,796,887 I320F probably benign Het
Olfr294 A T 7: 86,616,366 L93Q possibly damaging Het
Olfr557 A G 7: 102,698,270 T11A probably benign Het
Osbpl7 G A 11: 97,050,836 V62I probably benign Het
Pak1ip1 A G 13: 41,009,542 N246S probably damaging Het
Prim1 A G 10: 128,015,976 Y39C probably damaging Het
Prl3b1 G T 13: 27,243,844 V46L probably benign Het
Prss54 A T 8: 95,565,571 S127T probably benign Het
Rasal3 G A 17: 32,392,417 T912M probably damaging Het
Rrp12 T A 19: 41,883,778 T420S probably benign Het
Rspo1 A G 4: 125,005,038 N51D probably damaging Het
Rufy4 A G 1: 74,132,876 R253G probably benign Het
Scaf1 G A 7: 45,007,743 R571C unknown Het
Scn2a A T 2: 65,701,979 H645L probably damaging Het
Sec24b A G 3: 129,988,946 S1132P probably damaging Het
Slc1a2 A G 2: 102,755,945 K298R probably damaging Het
Slc25a54 T A 3: 109,107,257 N230K probably benign Het
Slc27a4 T G 2: 29,815,652 Y617* probably null Het
Slc2a10 T C 2: 165,515,349 S310P probably damaging Het
Snx33 C T 9: 56,925,867 R306H probably damaging Het
Spag9 A T 11: 94,089,432 probably null Het
Spg11 A T 2: 122,101,789 probably null Het
Sycp2l A G 13: 41,129,782 T165A probably damaging Het
Syt14 A G 1: 192,933,263 C189R probably damaging Het
Taar9 A T 10: 24,108,984 L184Q probably damaging Het
Tkt C T 14: 30,559,858 P111L probably damaging Het
Trpc1 A T 9: 95,721,144 L445Q possibly damaging Het
Usp53 A G 3: 122,949,710 S526P probably benign Het
Vps54 T G 11: 21,298,791 W447G probably damaging Het
Xirp2 A T 2: 67,509,833 H806L probably benign Het
Zfp451 A T 1: 33,802,570 H410Q unknown Het
Zfp688 A G 7: 127,419,312 C214R probably damaging Het
Zic4 A G 9: 91,379,121 D143G possibly damaging Het
Other mutations in Ccr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Ccr1 APN 9 123964053 missense probably benign 0.22
IGL00550:Ccr1 APN 9 123963636 missense probably damaging 1.00
IGL00934:Ccr1 APN 9 123963740 missense probably damaging 0.98
IGL01795:Ccr1 APN 9 123964112 nonsense probably null
IGL02447:Ccr1 APN 9 123963716 missense probably benign 0.01
PIT4431001:Ccr1 UTSW 9 123964194 missense probably benign
PIT4466001:Ccr1 UTSW 9 123963728 missense probably damaging 0.99
PIT4472001:Ccr1 UTSW 9 123963728 missense probably damaging 0.99
R0900:Ccr1 UTSW 9 123964334 missense possibly damaging 0.50
R0931:Ccr1 UTSW 9 123963790 missense probably damaging 1.00
R1165:Ccr1 UTSW 9 123963494 missense possibly damaging 0.51
R1386:Ccr1 UTSW 9 123963962 missense probably benign 0.05
R1513:Ccr1 UTSW 9 123964473 missense probably benign 0.00
R1615:Ccr1 UTSW 9 123963536 missense probably benign 0.00
R1833:Ccr1 UTSW 9 123964089 missense probably damaging 1.00
R1996:Ccr1 UTSW 9 123963514 missense probably benign 0.41
R3833:Ccr1 UTSW 9 123964287 missense possibly damaging 0.74
R4085:Ccr1 UTSW 9 123963950 missense probably benign
R4545:Ccr1 UTSW 9 123964400 missense probably benign 0.11
R4745:Ccr1 UTSW 9 123963948 missense probably benign 0.05
R5369:Ccr1 UTSW 9 123964289 missense probably damaging 0.98
R5415:Ccr1 UTSW 9 123964376 missense probably damaging 1.00
R5416:Ccr1 UTSW 9 123964376 missense probably damaging 1.00
R6446:Ccr1 UTSW 9 123964106 missense probably damaging 0.99
R7423:Ccr1 UTSW 9 123964385 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCCAAGAAGGTTTAGCTTTAGAG -3'
(R):5'- ACCTGGCTGTCTCTGATCTG -3'

Sequencing Primer
(F):5'- AGAGCTTGAAACCTCTTCCACTG -3'
(R):5'- CTTTACCTTTCTGGATTGACTACAAG -3'
Posted On2019-06-26