Incidental Mutation 'R7179:Fyn'
ID558846
Institutional Source Beutler Lab
Gene Symbol Fyn
Ensembl Gene ENSMUSG00000019843
Gene NameFyn proto-oncogene
SynonymsSrc Kinase p59
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7179 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location39368855-39565381 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 39532124 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 321 (D321G)
Ref Sequence ENSEMBL: ENSMUSP00000114188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063091] [ENSMUST00000099967] [ENSMUST00000126486] [ENSMUST00000135242] [ENSMUST00000136659] [ENSMUST00000146287]
Predicted Effect possibly damaging
Transcript: ENSMUST00000063091
AA Change: D321G

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000057707
Gene: ENSMUSG00000019843
AA Change: D321G

DomainStartEndE-ValueType
SH3 85 142 4.21e-24 SMART
SH2 147 237 3.86e-34 SMART
TyrKc 268 517 8.07e-133 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000099967
AA Change: D324G

PolyPhen 2 Score 0.871 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000097547
Gene: ENSMUSG00000019843
AA Change: D324G

DomainStartEndE-ValueType
SH3 85 142 4.21e-24 SMART
SH2 147 237 1.65e-33 SMART
TyrKc 271 520 1.08e-133 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123205
Predicted Effect possibly damaging
Transcript: ENSMUST00000126486
AA Change: D321G

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000115233
Gene: ENSMUSG00000019843
AA Change: D321G

DomainStartEndE-ValueType
SH3 85 142 4.21e-24 SMART
SH2 147 237 3.86e-34 SMART
TyrKc 268 517 8.07e-133 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000135242
AA Change: D321G

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000117111
Gene: ENSMUSG00000019843
AA Change: D321G

DomainStartEndE-ValueType
SH3 85 142 4.21e-24 SMART
SH2 147 237 3.86e-34 SMART
TyrKc 268 517 8.07e-133 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000136659
AA Change: D269G

PolyPhen 2 Score 0.570 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000118131
Gene: ENSMUSG00000019843
AA Change: D269G

DomainStartEndE-ValueType
SH3 85 142 4.21e-24 SMART
SH2 147 237 4.37e-33 SMART
TyrKc 222 465 7.5e-119 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000146287
AA Change: D321G

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000114188
Gene: ENSMUSG00000019843
AA Change: D321G

DomainStartEndE-ValueType
SH3 85 142 4.21e-24 SMART
SH2 147 237 3.86e-34 SMART
TyrKc 268 517 8.07e-133 SMART
Meta Mutation Damage Score 0.284 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protein-tyrosine kinase oncogene family. It encodes a membrane-associated tyrosine kinase that has been implicated in the control of cell growth. The protein associates with the p85 subunit of phosphatidylinositol 3-kinase and interacts with the fyn-binding protein. Alternatively spliced transcript variants encoding distinct isoforms exist. [provided by RefSeq, Jul 2008]
PHENOTYPE: Different targeted allele homozygotes show different defects, including seizure susceptibility, anxiety, impaired suckling, myelination, LTP and spatial learning, and defects in immune system, circadian rhythm, testes weight and olfactory bulb formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot13 A T 13: 24,818,171 I96K probably benign Het
Adam6a A G 12: 113,545,671 T555A probably benign Het
Alms1 C T 6: 85,621,369 P1059L probably benign Het
Apol7c T C 15: 77,525,643 T368A probably benign Het
Arfgef3 A T 10: 18,599,267 L1557Q probably damaging Het
Baz2a C T 10: 128,124,457 R1514W probably damaging Het
Bmp3 T A 5: 98,872,763 D348E probably damaging Het
Bves A G 10: 45,354,817 S295G probably damaging Het
Carmil1 A G 13: 24,020,069 C1328R probably benign Het
Ccnk T A 12: 108,187,258 Y93N probably damaging Het
Ccr1 A T 9: 123,964,052 V147D probably damaging Het
Cd24a G A 10: 43,582,640 G36S probably benign Het
Cep104 A G 4: 153,992,867 Y569C probably damaging Het
Chd2 A T 7: 73,475,420 I884N probably damaging Het
Cnst A T 1: 179,579,382 probably benign Het
Col22a1 A G 15: 71,933,413 L146P unknown Het
Col25a1 G T 3: 130,530,119 R321L probably damaging Het
Ctnnd2 T C 15: 30,683,364 Y504H possibly damaging Het
D3Ertd751e C A 3: 41,748,708 Q73K probably damaging Het
Dsc2 C T 18: 20,035,275 probably null Het
Eya1 A T 1: 14,302,852 S14R probably damaging Het
Fam71a G A 1: 191,164,021 R142C probably damaging Het
Flvcr2 T C 12: 85,747,191 F114L possibly damaging Het
Galnt5 A C 2: 57,998,609 M74L probably benign Het
Gas2l2 G A 11: 83,422,462 P675S probably benign Het
Gm9508 G T 10: 77,696,636 Q200K unknown Het
Greb1l G A 18: 10,544,576 S1390N probably benign Het
Hdac5 G T 11: 102,204,559 T430K possibly damaging Het
Hjurp TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTGCT TCT 1: 88,266,278 probably benign Het
Khnyn C T 14: 55,894,354 P578S probably damaging Het
Lepr A T 4: 101,745,659 T215S probably benign Het
Lrfn5 G A 12: 61,843,982 V686I probably benign Het
Mapkap1 T A 2: 34,518,700 H233Q possibly damaging Het
Mcm3 A G 1: 20,814,857 I201T probably damaging Het
Metrnl G A 11: 121,715,908 R263Q probably damaging Het
Mettl22 A G 16: 8,478,060 E71G probably benign Het
Muc16 T C 9: 18,642,008 T4330A probably benign Het
Mug1 A G 6: 121,857,420 T387A probably benign Het
Myh4 A G 11: 67,244,724 D379G probably benign Het
Nbas A G 12: 13,405,397 D1204G possibly damaging Het
Ncor2 T C 5: 125,055,783 K478E unknown Het
Olfr173 T A 16: 58,796,887 I320F probably benign Het
Olfr294 A T 7: 86,616,366 L93Q possibly damaging Het
Olfr557 A G 7: 102,698,270 T11A probably benign Het
Osbpl7 G A 11: 97,050,836 V62I probably benign Het
Pak1ip1 A G 13: 41,009,542 N246S probably damaging Het
Prim1 A G 10: 128,015,976 Y39C probably damaging Het
Prl3b1 G T 13: 27,243,844 V46L probably benign Het
Prss54 A T 8: 95,565,571 S127T probably benign Het
Rasal3 G A 17: 32,392,417 T912M probably damaging Het
Rrp12 T A 19: 41,883,778 T420S probably benign Het
Rspo1 A G 4: 125,005,038 N51D probably damaging Het
Rufy4 A G 1: 74,132,876 R253G probably benign Het
Scaf1 G A 7: 45,007,743 R571C unknown Het
Scn2a A T 2: 65,701,979 H645L probably damaging Het
Sec24b A G 3: 129,988,946 S1132P probably damaging Het
Slc1a2 A G 2: 102,755,945 K298R probably damaging Het
Slc25a54 T A 3: 109,107,257 N230K probably benign Het
Slc27a4 T G 2: 29,815,652 Y617* probably null Het
Slc2a10 T C 2: 165,515,349 S310P probably damaging Het
Snx33 C T 9: 56,925,867 R306H probably damaging Het
Sycp2l A G 13: 41,129,782 T165A probably damaging Het
Syt14 A G 1: 192,933,263 C189R probably damaging Het
Taar9 A T 10: 24,108,984 L184Q probably damaging Het
Tkt C T 14: 30,559,858 P111L probably damaging Het
Trpc1 A T 9: 95,721,144 L445Q possibly damaging Het
Usp53 A G 3: 122,949,710 S526P probably benign Het
Vps54 T G 11: 21,298,791 W447G probably damaging Het
Xirp2 A T 2: 67,509,833 H806L probably benign Het
Zfp451 A T 1: 33,802,570 H410Q unknown Het
Zfp688 A G 7: 127,419,312 C214R probably damaging Het
Zic4 A G 9: 91,379,121 D143G possibly damaging Het
Other mutations in Fyn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01988:Fyn APN 10 39533921 nonsense probably null
IGL02626:Fyn APN 10 39526802 missense probably damaging 1.00
H8562:Fyn UTSW 10 39511954 missense probably benign 0.00
R0128:Fyn UTSW 10 39511982 missense probably benign 0.00
R0130:Fyn UTSW 10 39511982 missense probably benign 0.00
R0336:Fyn UTSW 10 39526901 missense possibly damaging 0.52
R1446:Fyn UTSW 10 39522779 missense probably benign 0.43
R1498:Fyn UTSW 10 39532124 missense possibly damaging 0.90
R1539:Fyn UTSW 10 39532070 missense possibly damaging 0.94
R1912:Fyn UTSW 10 39526832 missense possibly damaging 0.94
R2198:Fyn UTSW 10 39529545 missense probably benign 0.13
R2339:Fyn UTSW 10 39522785 missense probably benign 0.00
R3107:Fyn UTSW 10 39551455 missense probably damaging 1.00
R3109:Fyn UTSW 10 39551455 missense probably damaging 1.00
R5068:Fyn UTSW 10 39526843 missense probably damaging 1.00
R5233:Fyn UTSW 10 39529940 missense probably benign
R5929:Fyn UTSW 10 39551461 missense probably damaging 1.00
R6360:Fyn UTSW 10 39526883 missense possibly damaging 0.83
R6379:Fyn UTSW 10 39455074 start gained probably benign
R6490:Fyn UTSW 10 39551402 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATTTTATGCACAAAGTTGCTGGTC -3'
(R):5'- AGGGGCAAACTCCATGTTCC -3'

Sequencing Primer
(F):5'- GTTGCTGGTCAAAATTATTTTTCCC -3'
(R):5'- CTAAGTGTTATCCTGAGTGAGCAGAG -3'
Posted On2019-06-26