Incidental Mutation 'R7179:Pak1ip1'
ID558866
Institutional Source Beutler Lab
Gene Symbol Pak1ip1
Ensembl Gene ENSMUSG00000038683
Gene NamePAK1 interacting protein 1
Synonyms5830431I15Rik, Gdpd1, 5930415H02Rik, p21-activated protein kinase-interacting protein 1, PIP1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7179 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location41001023-41013015 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 41009542 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 246 (N246S)
Ref Sequence ENSEMBL: ENSMUSP00000040846 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046951]
Predicted Effect probably damaging
Transcript: ENSMUST00000046951
AA Change: N246S

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000040846
Gene: ENSMUSG00000038683
AA Change: N246S

DomainStartEndE-ValueType
WD40 29 68 6.89e-3 SMART
WD40 71 109 1.19e-6 SMART
WD40 112 151 1.59e-7 SMART
Blast:WD40 156 190 4e-10 BLAST
WD40 194 231 3.45e-1 SMART
WD40 234 275 6.89e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency 100% (76/76)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU mutagenesis exhibit median orofacial clefting, developmental delay and death around E14. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot13 A T 13: 24,818,171 I96K probably benign Het
Adam6a A G 12: 113,545,671 T555A probably benign Het
Alms1 C T 6: 85,621,369 P1059L probably benign Het
Apol7c T C 15: 77,525,643 T368A probably benign Het
Arfgef3 A T 10: 18,599,267 L1557Q probably damaging Het
Baz2a C T 10: 128,124,457 R1514W probably damaging Het
Bmp3 T A 5: 98,872,763 D348E probably damaging Het
Bves A G 10: 45,354,817 S295G probably damaging Het
Carmil1 A G 13: 24,020,069 C1328R probably benign Het
Ccnk T A 12: 108,187,258 Y93N probably damaging Het
Ccr1 A T 9: 123,964,052 V147D probably damaging Het
Cd24a G A 10: 43,582,640 G36S probably benign Het
Cep104 A G 4: 153,992,867 Y569C probably damaging Het
Chd2 A T 7: 73,475,420 I884N probably damaging Het
Cnst A T 1: 179,579,382 probably benign Het
Col22a1 A G 15: 71,933,413 L146P unknown Het
Col25a1 G T 3: 130,530,119 R321L probably damaging Het
Ctnnd2 T C 15: 30,683,364 Y504H possibly damaging Het
D3Ertd751e C A 3: 41,748,708 Q73K probably damaging Het
Dsc2 C T 18: 20,035,275 probably null Het
Eya1 A T 1: 14,302,852 S14R probably damaging Het
Fam131c A T 4: 141,383,017 probably null Het
Fam71a G A 1: 191,164,021 R142C probably damaging Het
Flvcr2 T C 12: 85,747,191 F114L possibly damaging Het
Fyn A G 10: 39,532,124 D321G possibly damaging Het
Galnt5 A C 2: 57,998,609 M74L probably benign Het
Gas2l2 G A 11: 83,422,462 P675S probably benign Het
Gm9508 G T 10: 77,696,636 Q200K unknown Het
Greb1l G A 18: 10,544,576 S1390N probably benign Het
Hdac5 G T 11: 102,204,559 T430K possibly damaging Het
Hjurp TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTGCT TCT 1: 88,266,278 probably benign Het
Khnyn C T 14: 55,894,354 P578S probably damaging Het
Lepr A T 4: 101,745,659 T215S probably benign Het
Lrfn5 G A 12: 61,843,982 V686I probably benign Het
Mapkap1 T A 2: 34,518,700 H233Q possibly damaging Het
Mcm3 A G 1: 20,814,857 I201T probably damaging Het
Metrnl G A 11: 121,715,908 R263Q probably damaging Het
Mettl22 A G 16: 8,478,060 E71G probably benign Het
Muc16 T C 9: 18,642,008 T4330A probably benign Het
Mug1 A G 6: 121,857,420 T387A probably benign Het
Myh4 A G 11: 67,244,724 D379G probably benign Het
Nbas A G 12: 13,405,397 D1204G possibly damaging Het
Ncor2 T C 5: 125,055,783 K478E unknown Het
Olfr173 T A 16: 58,796,887 I320F probably benign Het
Olfr294 A T 7: 86,616,366 L93Q possibly damaging Het
Olfr557 A G 7: 102,698,270 T11A probably benign Het
Osbpl7 G A 11: 97,050,836 V62I probably benign Het
Prim1 A G 10: 128,015,976 Y39C probably damaging Het
Prl3b1 G T 13: 27,243,844 V46L probably benign Het
Prss54 A T 8: 95,565,571 S127T probably benign Het
Rasal3 G A 17: 32,392,417 T912M probably damaging Het
Rrp12 T A 19: 41,883,778 T420S probably benign Het
Rspo1 A G 4: 125,005,038 N51D probably damaging Het
Rufy4 A G 1: 74,132,876 R253G probably benign Het
Scaf1 G A 7: 45,007,743 R571C unknown Het
Scn2a A T 2: 65,701,979 H645L probably damaging Het
Sec24b A G 3: 129,988,946 S1132P probably damaging Het
Slc1a2 A G 2: 102,755,945 K298R probably damaging Het
Slc25a54 T A 3: 109,107,257 N230K probably benign Het
Slc27a4 T G 2: 29,815,652 Y617* probably null Het
Slc2a10 T C 2: 165,515,349 S310P probably damaging Het
Snx33 C T 9: 56,925,867 R306H probably damaging Het
Spag9 A T 11: 94,089,432 probably null Het
Spg11 A T 2: 122,101,789 probably null Het
Sycp2l A G 13: 41,129,782 T165A probably damaging Het
Syt14 A G 1: 192,933,263 C189R probably damaging Het
Taar9 A T 10: 24,108,984 L184Q probably damaging Het
Tkt C T 14: 30,559,858 P111L probably damaging Het
Trpc1 A T 9: 95,721,144 L445Q possibly damaging Het
Usp53 A G 3: 122,949,710 S526P probably benign Het
Vps54 T G 11: 21,298,791 W447G probably damaging Het
Xirp2 A T 2: 67,509,833 H806L probably benign Het
Zfp451 A T 1: 33,802,570 H410Q unknown Het
Zfp688 A G 7: 127,419,312 C214R probably damaging Het
Zic4 A G 9: 91,379,121 D143G possibly damaging Het
Other mutations in Pak1ip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Pak1ip1 APN 13 41008018 missense possibly damaging 0.66
IGL00848:Pak1ip1 APN 13 41012623 missense probably benign 0.18
IGL02327:Pak1ip1 APN 13 41012417 missense probably benign
R0383:Pak1ip1 UTSW 13 41012604 missense probably benign 0.00
R1706:Pak1ip1 UTSW 13 41012688 missense probably benign 0.00
R1851:Pak1ip1 UTSW 13 41011232 missense possibly damaging 0.90
R1852:Pak1ip1 UTSW 13 41011232 missense possibly damaging 0.90
R4255:Pak1ip1 UTSW 13 41011156 intron probably benign
R4326:Pak1ip1 UTSW 13 41004756 missense possibly damaging 0.82
R5062:Pak1ip1 UTSW 13 41008145 splice site probably benign
R5929:Pak1ip1 UTSW 13 41004800 missense probably benign 0.42
R6101:Pak1ip1 UTSW 13 41004885 missense probably damaging 1.00
R6105:Pak1ip1 UTSW 13 41004885 missense probably damaging 1.00
R6198:Pak1ip1 UTSW 13 41001410 missense probably benign
R7367:Pak1ip1 UTSW 13 41008895 missense probably damaging 1.00
R7487:Pak1ip1 UTSW 13 41009255 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCTCAGTGAGTTCCGGACAG -3'
(R):5'- TTCGCTCAAACATGCTTGC -3'

Sequencing Primer
(F):5'- TGAGTTCCGGACAGCAGGG -3'
(R):5'- CGCTCAAACATGCTTGCTATTC -3'
Posted On2019-06-26