Incidental Mutation 'R7179:Khnyn'
ID558869
Institutional Source Beutler Lab
Gene Symbol Khnyn
Ensembl Gene ENSMUSG00000047153
Gene NameKH and NYN domain containing
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R7179 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location55884947-55898775 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 55894354 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 578 (P578S)
Ref Sequence ENSEMBL: ENSMUSP00000022831 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022831] [ENSMUST00000111325] [ENSMUST00000226273] [ENSMUST00000227032] [ENSMUST00000227211] [ENSMUST00000228462]
Predicted Effect probably damaging
Transcript: ENSMUST00000022831
AA Change: P578S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022831
Gene: ENSMUSG00000047153
AA Change: P578S

DomainStartEndE-ValueType
low complexity region 350 365 N/A INTRINSIC
low complexity region 367 380 N/A INTRINSIC
Pfam:RNase_Zc3h12a 429 582 1.9e-66 PFAM
low complexity region 623 637 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111325
SMART Domains Protein: ENSMUSP00000106957
Gene: ENSMUSG00000022223

DomainStartEndE-ValueType
Pfam:Epimerase 3 216 2.7e-7 PFAM
Pfam:DUF1731 245 291 5.9e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226273
Predicted Effect probably benign
Transcript: ENSMUST00000227032
Predicted Effect probably benign
Transcript: ENSMUST00000227211
Predicted Effect probably benign
Transcript: ENSMUST00000227387
Predicted Effect probably benign
Transcript: ENSMUST00000228462
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein with a C-terminal RNA modifying domain that belongs to a family of ribonucleases typified by eukaryotic Nedd4-binding protein1 and the bacterial YacP-like nucleases (NYN). The NYN domain shares a common protein fold with two other groups of nucleases, the PilT N-terminal nuclease and FLAP nuclease superfamilies. In addition to the NYN domain, the protein encoded by this gene also contains an N-terminal K homology RNA-binding domain. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot13 A T 13: 24,818,171 I96K probably benign Het
Adam6a A G 12: 113,545,671 T555A probably benign Het
Alms1 C T 6: 85,621,369 P1059L probably benign Het
Apol7c T C 15: 77,525,643 T368A probably benign Het
Arfgef3 A T 10: 18,599,267 L1557Q probably damaging Het
Baz2a C T 10: 128,124,457 R1514W probably damaging Het
Bmp3 T A 5: 98,872,763 D348E probably damaging Het
Bves A G 10: 45,354,817 S295G probably damaging Het
Carmil1 A G 13: 24,020,069 C1328R probably benign Het
Ccnk T A 12: 108,187,258 Y93N probably damaging Het
Ccr1 A T 9: 123,964,052 V147D probably damaging Het
Cd24a G A 10: 43,582,640 G36S probably benign Het
Cep104 A G 4: 153,992,867 Y569C probably damaging Het
Chd2 A T 7: 73,475,420 I884N probably damaging Het
Cnst A T 1: 179,579,382 probably benign Het
Col22a1 A G 15: 71,933,413 L146P unknown Het
Col25a1 G T 3: 130,530,119 R321L probably damaging Het
Ctnnd2 T C 15: 30,683,364 Y504H possibly damaging Het
D3Ertd751e C A 3: 41,748,708 Q73K probably damaging Het
Dsc2 C T 18: 20,035,275 probably null Het
Eya1 A T 1: 14,302,852 S14R probably damaging Het
Fam71a G A 1: 191,164,021 R142C probably damaging Het
Flvcr2 T C 12: 85,747,191 F114L possibly damaging Het
Fyn A G 10: 39,532,124 D321G possibly damaging Het
Galnt5 A C 2: 57,998,609 M74L probably benign Het
Gas2l2 G A 11: 83,422,462 P675S probably benign Het
Gm9508 G T 10: 77,696,636 Q200K unknown Het
Greb1l G A 18: 10,544,576 S1390N probably benign Het
Hdac5 G T 11: 102,204,559 T430K possibly damaging Het
Hjurp TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTGCT TCT 1: 88,266,278 probably benign Het
Lepr A T 4: 101,745,659 T215S probably benign Het
Lrfn5 G A 12: 61,843,982 V686I probably benign Het
Mapkap1 T A 2: 34,518,700 H233Q possibly damaging Het
Mcm3 A G 1: 20,814,857 I201T probably damaging Het
Metrnl G A 11: 121,715,908 R263Q probably damaging Het
Mettl22 A G 16: 8,478,060 E71G probably benign Het
Muc16 T C 9: 18,642,008 T4330A probably benign Het
Mug1 A G 6: 121,857,420 T387A probably benign Het
Myh4 A G 11: 67,244,724 D379G probably benign Het
Nbas A G 12: 13,405,397 D1204G possibly damaging Het
Ncor2 T C 5: 125,055,783 K478E unknown Het
Olfr173 T A 16: 58,796,887 I320F probably benign Het
Olfr294 A T 7: 86,616,366 L93Q possibly damaging Het
Olfr557 A G 7: 102,698,270 T11A probably benign Het
Osbpl7 G A 11: 97,050,836 V62I probably benign Het
Pak1ip1 A G 13: 41,009,542 N246S probably damaging Het
Prim1 A G 10: 128,015,976 Y39C probably damaging Het
Prl3b1 G T 13: 27,243,844 V46L probably benign Het
Prss54 A T 8: 95,565,571 S127T probably benign Het
Rasal3 G A 17: 32,392,417 T912M probably damaging Het
Rrp12 T A 19: 41,883,778 T420S probably benign Het
Rspo1 A G 4: 125,005,038 N51D probably damaging Het
Rufy4 A G 1: 74,132,876 R253G probably benign Het
Scaf1 G A 7: 45,007,743 R571C unknown Het
Scn2a A T 2: 65,701,979 H645L probably damaging Het
Sec24b A G 3: 129,988,946 S1132P probably damaging Het
Slc1a2 A G 2: 102,755,945 K298R probably damaging Het
Slc25a54 T A 3: 109,107,257 N230K probably benign Het
Slc27a4 T G 2: 29,815,652 Y617* probably null Het
Slc2a10 T C 2: 165,515,349 S310P probably damaging Het
Snx33 C T 9: 56,925,867 R306H probably damaging Het
Sycp2l A G 13: 41,129,782 T165A probably damaging Het
Syt14 A G 1: 192,933,263 C189R probably damaging Het
Taar9 A T 10: 24,108,984 L184Q probably damaging Het
Tkt C T 14: 30,559,858 P111L probably damaging Het
Trpc1 A T 9: 95,721,144 L445Q possibly damaging Het
Usp53 A G 3: 122,949,710 S526P probably benign Het
Vps54 T G 11: 21,298,791 W447G probably damaging Het
Xirp2 A T 2: 67,509,833 H806L probably benign Het
Zfp451 A T 1: 33,802,570 H410Q unknown Het
Zfp688 A G 7: 127,419,312 C214R probably damaging Het
Zic4 A G 9: 91,379,121 D143G possibly damaging Het
Other mutations in Khnyn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01746:Khnyn APN 14 55886982 missense probably benign 0.02
IGL01924:Khnyn APN 14 55894969 missense probably benign 0.03
IGL01990:Khnyn APN 14 55887588 missense possibly damaging 0.87
R0310:Khnyn UTSW 14 55887968 missense probably damaging 1.00
R1822:Khnyn UTSW 14 55885852 missense probably damaging 1.00
R2248:Khnyn UTSW 14 55886738 missense probably benign 0.30
R4333:Khnyn UTSW 14 55894042 missense probably damaging 1.00
R4334:Khnyn UTSW 14 55894042 missense probably damaging 1.00
R4600:Khnyn UTSW 14 55886981 missense probably benign 0.02
R4731:Khnyn UTSW 14 55886489 splice site probably null
R4732:Khnyn UTSW 14 55886489 splice site probably null
R4733:Khnyn UTSW 14 55886489 splice site probably null
R5063:Khnyn UTSW 14 55887203 nonsense probably null
R5434:Khnyn UTSW 14 55887500 missense probably damaging 1.00
R5908:Khnyn UTSW 14 55887066 missense probably benign
R5928:Khnyn UTSW 14 55885887 missense probably damaging 1.00
R6144:Khnyn UTSW 14 55887839 missense probably damaging 0.98
R6147:Khnyn UTSW 14 55887603 missense probably damaging 1.00
R6353:Khnyn UTSW 14 55894303 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GAGTCTGACAAGTGGATGGC -3'
(R):5'- GGAGGTTTTAAAGGCCAGGC -3'

Sequencing Primer
(F):5'- TCTGGCCACTGGGTGAGAATC -3'
(R):5'- GCCAGGCCAGCAAACTCAAG -3'
Posted On2019-06-26