Incidental Mutation 'R7179:Rasal3'
ID558875
Institutional Source Beutler Lab
Gene Symbol Rasal3
Ensembl Gene ENSMUSG00000052142
Gene NameRAS protein activator like 3
SynonymsA430107D22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R7179 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location32390659-32403583 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 32392417 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 912 (T912M)
Ref Sequence ENSEMBL: ENSMUSP00000123141 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063824] [ENSMUST00000064694] [ENSMUST00000087703] [ENSMUST00000135618] [ENSMUST00000136375] [ENSMUST00000137458] [ENSMUST00000163107] [ENSMUST00000165912] [ENSMUST00000169280] [ENSMUST00000170603] [ENSMUST00000170617] [ENSMUST00000171728]
Predicted Effect probably damaging
Transcript: ENSMUST00000063824
AA Change: T910M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000064084
Gene: ENSMUSG00000052142
AA Change: T910M

DomainStartEndE-ValueType
low complexity region 57 72 N/A INTRINSIC
low complexity region 120 137 N/A INTRINSIC
PH 165 323 3.94e0 SMART
Blast:RasGAP 354 381 9e-8 BLAST
low complexity region 385 402 N/A INTRINSIC
RasGAP 433 755 2.03e-81 SMART
low complexity region 826 839 N/A INTRINSIC
coiled coil region 932 1013 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000064694
SMART Domains Protein: ENSMUSP00000069443
Gene: ENSMUSG00000024050

DomainStartEndE-ValueType
low complexity region 27 35 N/A INTRINSIC
ZnF_C2H2 74 96 8.67e-1 SMART
ZnF_C2H2 175 197 4.72e-2 SMART
ZnF_C2H2 348 370 1.67e-2 SMART
low complexity region 401 412 N/A INTRINSIC
low complexity region 439 458 N/A INTRINSIC
ZnF_C2H2 532 554 1.67e-2 SMART
low complexity region 576 588 N/A INTRINSIC
low complexity region 607 623 N/A INTRINSIC
ZnF_C2H2 702 724 1.41e0 SMART
low complexity region 784 793 N/A INTRINSIC
low complexity region 869 887 N/A INTRINSIC
ZnF_C2H2 901 927 1.06e2 SMART
low complexity region 936 956 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000087703
SMART Domains Protein: ENSMUSP00000084993
Gene: ENSMUSG00000024050

DomainStartEndE-ValueType
low complexity region 27 35 N/A INTRINSIC
ZnF_C2H2 74 96 8.67e-1 SMART
ZnF_C2H2 175 197 4.72e-2 SMART
ZnF_C2H2 348 370 1.67e-2 SMART
low complexity region 401 412 N/A INTRINSIC
low complexity region 439 458 N/A INTRINSIC
ZnF_C2H2 531 553 1.67e-2 SMART
low complexity region 575 587 N/A INTRINSIC
low complexity region 606 622 N/A INTRINSIC
ZnF_C2H2 701 723 1.41e0 SMART
low complexity region 783 792 N/A INTRINSIC
low complexity region 868 886 N/A INTRINSIC
ZnF_C2H2 900 926 1.06e2 SMART
low complexity region 935 955 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000135618
AA Change: T888M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000116107
Gene: ENSMUSG00000052142
AA Change: T888M

DomainStartEndE-ValueType
low complexity region 35 50 N/A INTRINSIC
low complexity region 98 115 N/A INTRINSIC
PH 143 301 3.94e0 SMART
Blast:RasGAP 332 359 9e-8 BLAST
low complexity region 363 380 N/A INTRINSIC
RasGAP 411 733 2.03e-81 SMART
low complexity region 804 817 N/A INTRINSIC
coiled coil region 910 991 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136375
SMART Domains Protein: ENSMUSP00000118738
Gene: ENSMUSG00000052142

DomainStartEndE-ValueType
low complexity region 35 50 N/A INTRINSIC
low complexity region 98 115 N/A INTRINSIC
PH 143 301 3.94e0 SMART
Blast:RasGAP 332 359 7e-8 BLAST
low complexity region 363 380 N/A INTRINSIC
Pfam:RasGAP 483 579 6.4e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000137458
AA Change: T912M

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000123141
Gene: ENSMUSG00000052142
AA Change: T912M

DomainStartEndE-ValueType
low complexity region 35 50 N/A INTRINSIC
low complexity region 119 140 N/A INTRINSIC
PH 167 325 3.94e0 SMART
Blast:RasGAP 356 383 9e-8 BLAST
low complexity region 387 404 N/A INTRINSIC
RasGAP 435 757 2.03e-81 SMART
low complexity region 828 841 N/A INTRINSIC
coiled coil region 934 1015 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163107
SMART Domains Protein: ENSMUSP00000127943
Gene: ENSMUSG00000024050

DomainStartEndE-ValueType
low complexity region 27 35 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165912
SMART Domains Protein: ENSMUSP00000127651
Gene: ENSMUSG00000024050

DomainStartEndE-ValueType
low complexity region 27 35 N/A INTRINSIC
ZnF_C2H2 74 96 8.67e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169280
SMART Domains Protein: ENSMUSP00000129700
Gene: ENSMUSG00000024050

DomainStartEndE-ValueType
low complexity region 27 35 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170603
SMART Domains Protein: ENSMUSP00000128241
Gene: ENSMUSG00000024050

DomainStartEndE-ValueType
low complexity region 27 35 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170617
SMART Domains Protein: ENSMUSP00000130517
Gene: ENSMUSG00000024050

DomainStartEndE-ValueType
low complexity region 27 35 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171728
SMART Domains Protein: ENSMUSP00000130054
Gene: ENSMUSG00000024050

DomainStartEndE-ValueType
low complexity region 27 35 N/A INTRINSIC
Meta Mutation Damage Score 0.124 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency 100% (76/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the Ras GTPase-activating proteins (RasGAP) family and encodes a protein with pleckstrin homology (PH), C2, and Ras GTPase-activation protein (RasGAP) domains. This protein is localized near or at the plasma membrane when expressed exogenously. Reduced expression of this gene in some cell lines resulted in increased levels of the active form of Ras (Ras-GTP), suggesting that this gene may play a role in negatively regulating the Ras signaling pathway. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced NT T cells in the liver, increased granulocytes in the bone marrow and decreased susceptibility to alpha-GalCer-induced liver injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot13 A T 13: 24,818,171 I96K probably benign Het
Adam6a A G 12: 113,545,671 T555A probably benign Het
Alms1 C T 6: 85,621,369 P1059L probably benign Het
Apol7c T C 15: 77,525,643 T368A probably benign Het
Arfgef3 A T 10: 18,599,267 L1557Q probably damaging Het
Baz2a C T 10: 128,124,457 R1514W probably damaging Het
Bmp3 T A 5: 98,872,763 D348E probably damaging Het
Bves A G 10: 45,354,817 S295G probably damaging Het
Carmil1 A G 13: 24,020,069 C1328R probably benign Het
Ccnk T A 12: 108,187,258 Y93N probably damaging Het
Ccr1 A T 9: 123,964,052 V147D probably damaging Het
Cd24a G A 10: 43,582,640 G36S probably benign Het
Cep104 A G 4: 153,992,867 Y569C probably damaging Het
Chd2 A T 7: 73,475,420 I884N probably damaging Het
Cnst A T 1: 179,579,382 probably benign Het
Col22a1 A G 15: 71,933,413 L146P unknown Het
Col25a1 G T 3: 130,530,119 R321L probably damaging Het
Ctnnd2 T C 15: 30,683,364 Y504H possibly damaging Het
D3Ertd751e C A 3: 41,748,708 Q73K probably damaging Het
Dsc2 C T 18: 20,035,275 probably null Het
Eya1 A T 1: 14,302,852 S14R probably damaging Het
Fam131c A T 4: 141,383,017 probably null Het
Fam71a G A 1: 191,164,021 R142C probably damaging Het
Flvcr2 T C 12: 85,747,191 F114L possibly damaging Het
Fyn A G 10: 39,532,124 D321G possibly damaging Het
Galnt5 A C 2: 57,998,609 M74L probably benign Het
Gas2l2 G A 11: 83,422,462 P675S probably benign Het
Gm9508 G T 10: 77,696,636 Q200K unknown Het
Greb1l G A 18: 10,544,576 S1390N probably benign Het
Hdac5 G T 11: 102,204,559 T430K possibly damaging Het
Hjurp TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTGCT TCT 1: 88,266,278 probably benign Het
Khnyn C T 14: 55,894,354 P578S probably damaging Het
Lepr A T 4: 101,745,659 T215S probably benign Het
Lrfn5 G A 12: 61,843,982 V686I probably benign Het
Mapkap1 T A 2: 34,518,700 H233Q possibly damaging Het
Mcm3 A G 1: 20,814,857 I201T probably damaging Het
Metrnl G A 11: 121,715,908 R263Q probably damaging Het
Mettl22 A G 16: 8,478,060 E71G probably benign Het
Muc16 T C 9: 18,642,008 T4330A probably benign Het
Mug1 A G 6: 121,857,420 T387A probably benign Het
Myh4 A G 11: 67,244,724 D379G probably benign Het
Nbas A G 12: 13,405,397 D1204G possibly damaging Het
Ncor2 T C 5: 125,055,783 K478E unknown Het
Olfr173 T A 16: 58,796,887 I320F probably benign Het
Olfr294 A T 7: 86,616,366 L93Q possibly damaging Het
Olfr557 A G 7: 102,698,270 T11A probably benign Het
Osbpl7 G A 11: 97,050,836 V62I probably benign Het
Pak1ip1 A G 13: 41,009,542 N246S probably damaging Het
Prim1 A G 10: 128,015,976 Y39C probably damaging Het
Prl3b1 G T 13: 27,243,844 V46L probably benign Het
Prss54 A T 8: 95,565,571 S127T probably benign Het
Rrp12 T A 19: 41,883,778 T420S probably benign Het
Rspo1 A G 4: 125,005,038 N51D probably damaging Het
Rufy4 A G 1: 74,132,876 R253G probably benign Het
Scaf1 G A 7: 45,007,743 R571C unknown Het
Scn2a A T 2: 65,701,979 H645L probably damaging Het
Sec24b A G 3: 129,988,946 S1132P probably damaging Het
Slc1a2 A G 2: 102,755,945 K298R probably damaging Het
Slc25a54 T A 3: 109,107,257 N230K probably benign Het
Slc27a4 T G 2: 29,815,652 Y617* probably null Het
Slc2a10 T C 2: 165,515,349 S310P probably damaging Het
Snx33 C T 9: 56,925,867 R306H probably damaging Het
Spag9 A T 11: 94,089,432 probably null Het
Spg11 A T 2: 122,101,789 probably null Het
Sycp2l A G 13: 41,129,782 T165A probably damaging Het
Syt14 A G 1: 192,933,263 C189R probably damaging Het
Taar9 A T 10: 24,108,984 L184Q probably damaging Het
Tkt C T 14: 30,559,858 P111L probably damaging Het
Trpc1 A T 9: 95,721,144 L445Q possibly damaging Het
Usp53 A G 3: 122,949,710 S526P probably benign Het
Vps54 T G 11: 21,298,791 W447G probably damaging Het
Xirp2 A T 2: 67,509,833 H806L probably benign Het
Zfp451 A T 1: 33,802,570 H410Q unknown Het
Zfp688 A G 7: 127,419,312 C214R probably damaging Het
Zic4 A G 9: 91,379,121 D143G possibly damaging Het
Other mutations in Rasal3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01126:Rasal3 APN 17 32397405 missense possibly damaging 0.89
IGL02291:Rasal3 APN 17 32393737 unclassified probably benign
IGL02346:Rasal3 APN 17 32399349 missense probably damaging 1.00
IGL02422:Rasal3 APN 17 32398973 missense probably benign 0.11
Beaten UTSW 17 32391344 missense probably benign 0.05
bent UTSW 17 32396781 missense probably damaging 1.00
bowed UTSW 17 32396790 missense probably damaging 1.00
kinked UTSW 17 32396350 nonsense probably null
R0057:Rasal3 UTSW 17 32391383 missense probably benign 0.00
R0133:Rasal3 UTSW 17 32403383 start codon destroyed probably null 0.89
R0180:Rasal3 UTSW 17 32399405 missense probably benign
R0403:Rasal3 UTSW 17 32392790 unclassified probably null
R0452:Rasal3 UTSW 17 32395817 splice site probably benign
R0600:Rasal3 UTSW 17 32393526 missense probably damaging 0.99
R0760:Rasal3 UTSW 17 32392172 missense probably benign 0.00
R1438:Rasal3 UTSW 17 32393535 unclassified probably null
R1669:Rasal3 UTSW 17 32403098 missense possibly damaging 0.81
R1914:Rasal3 UTSW 17 32396350 nonsense probably null
R1928:Rasal3 UTSW 17 32397353 missense probably damaging 1.00
R2002:Rasal3 UTSW 17 32393611 missense probably damaging 1.00
R3053:Rasal3 UTSW 17 32403439 missense probably benign 0.03
R3770:Rasal3 UTSW 17 32392151 missense probably damaging 0.99
R3870:Rasal3 UTSW 17 32393548 missense possibly damaging 0.94
R4491:Rasal3 UTSW 17 32391385 missense probably damaging 0.99
R4783:Rasal3 UTSW 17 32396781 missense probably damaging 1.00
R4788:Rasal3 UTSW 17 32399338 missense probably benign 0.00
R4903:Rasal3 UTSW 17 32397383 missense probably damaging 1.00
R5185:Rasal3 UTSW 17 32396790 missense probably damaging 1.00
R5372:Rasal3 UTSW 17 32391344 missense probably benign 0.05
R5433:Rasal3 UTSW 17 32393601 missense probably benign 0.00
R5472:Rasal3 UTSW 17 32396669 missense probably damaging 1.00
R5920:Rasal3 UTSW 17 32395169 missense probably damaging 1.00
R6436:Rasal3 UTSW 17 32397504 missense probably damaging 1.00
R6837:Rasal3 UTSW 17 32403070 missense probably benign 0.17
R7047:Rasal3 UTSW 17 32396484 missense probably damaging 1.00
R7109:Rasal3 UTSW 17 32392709 missense probably damaging 1.00
X0027:Rasal3 UTSW 17 32391219 missense probably damaging 1.00
X0027:Rasal3 UTSW 17 32392526 missense probably benign 0.00
X0065:Rasal3 UTSW 17 32403286 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTGGGAAGACAGTAGCTG -3'
(R):5'- TTTCAAGGGGCAGGAAGCTG -3'

Sequencing Primer
(F):5'- GCTGTAATCTGACATTTCTTCAGG -3'
(R):5'- ACACAGAGCGTCCCTGC -3'
Posted On2019-06-26