Incidental Mutation 'R7179:Greb1l'
ID558876
Institutional Source Beutler Lab
Gene Symbol Greb1l
Ensembl Gene ENSMUSG00000042942
Gene Namegrowth regulation by estrogen in breast cancer-like
SynonymsAK220484, mKIAA4095
MMRRC Submission
Accession Numbers

Genbank: NM_001083628; MGI: 3576497

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7179 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location10325177-10562934 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 10544576 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 1390 (S1390N)
Ref Sequence ENSEMBL: ENSMUSP00000049003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048977] [ENSMUST00000172680]
Predicted Effect probably benign
Transcript: ENSMUST00000048977
AA Change: S1390N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000049003
Gene: ENSMUSG00000042942
AA Change: S1390N

DomainStartEndE-ValueType
Pfam:GREB1 1 1172 N/A PFAM
Pfam:GREB1 1154 1913 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172680
SMART Domains Protein: ENSMUSP00000134314
Gene: ENSMUSG00000042942

DomainStartEndE-ValueType
low complexity region 116 129 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency 100% (76/76)
Allele List at MGI

All alleles(5) : Targeted, other(2) Gene trapped(3)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot13 A T 13: 24,818,171 I96K probably benign Het
Adam6a A G 12: 113,545,671 T555A probably benign Het
Alms1 C T 6: 85,621,369 P1059L probably benign Het
Apol7c T C 15: 77,525,643 T368A probably benign Het
Arfgef3 A T 10: 18,599,267 L1557Q probably damaging Het
Baz2a C T 10: 128,124,457 R1514W probably damaging Het
Bmp3 T A 5: 98,872,763 D348E probably damaging Het
Bves A G 10: 45,354,817 S295G probably damaging Het
Carmil1 A G 13: 24,020,069 C1328R probably benign Het
Ccnk T A 12: 108,187,258 Y93N probably damaging Het
Ccr1 A T 9: 123,964,052 V147D probably damaging Het
Cd24a G A 10: 43,582,640 G36S probably benign Het
Cep104 A G 4: 153,992,867 Y569C probably damaging Het
Chd2 A T 7: 73,475,420 I884N probably damaging Het
Cnst A T 1: 179,579,382 probably benign Het
Col22a1 A G 15: 71,933,413 L146P unknown Het
Col25a1 G T 3: 130,530,119 R321L probably damaging Het
Ctnnd2 T C 15: 30,683,364 Y504H possibly damaging Het
D3Ertd751e C A 3: 41,748,708 Q73K probably damaging Het
Dsc2 C T 18: 20,035,275 probably null Het
Eya1 A T 1: 14,302,852 S14R probably damaging Het
Fam131c A T 4: 141,383,017 probably null Het
Fam71a G A 1: 191,164,021 R142C probably damaging Het
Flvcr2 T C 12: 85,747,191 F114L possibly damaging Het
Fyn A G 10: 39,532,124 D321G possibly damaging Het
Galnt5 A C 2: 57,998,609 M74L probably benign Het
Gas2l2 G A 11: 83,422,462 P675S probably benign Het
Gm9508 G T 10: 77,696,636 Q200K unknown Het
Hdac5 G T 11: 102,204,559 T430K possibly damaging Het
Hjurp TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTGCT TCT 1: 88,266,278 probably benign Het
Khnyn C T 14: 55,894,354 P578S probably damaging Het
Lepr A T 4: 101,745,659 T215S probably benign Het
Lrfn5 G A 12: 61,843,982 V686I probably benign Het
Mapkap1 T A 2: 34,518,700 H233Q possibly damaging Het
Mcm3 A G 1: 20,814,857 I201T probably damaging Het
Metrnl G A 11: 121,715,908 R263Q probably damaging Het
Mettl22 A G 16: 8,478,060 E71G probably benign Het
Muc16 T C 9: 18,642,008 T4330A probably benign Het
Mug1 A G 6: 121,857,420 T387A probably benign Het
Myh4 A G 11: 67,244,724 D379G probably benign Het
Nbas A G 12: 13,405,397 D1204G possibly damaging Het
Ncor2 T C 5: 125,055,783 K478E unknown Het
Olfr173 T A 16: 58,796,887 I320F probably benign Het
Olfr294 A T 7: 86,616,366 L93Q possibly damaging Het
Olfr557 A G 7: 102,698,270 T11A probably benign Het
Osbpl7 G A 11: 97,050,836 V62I probably benign Het
Pak1ip1 A G 13: 41,009,542 N246S probably damaging Het
Prim1 A G 10: 128,015,976 Y39C probably damaging Het
Prl3b1 G T 13: 27,243,844 V46L probably benign Het
Prss54 A T 8: 95,565,571 S127T probably benign Het
Rasal3 G A 17: 32,392,417 T912M probably damaging Het
Rrp12 T A 19: 41,883,778 T420S probably benign Het
Rspo1 A G 4: 125,005,038 N51D probably damaging Het
Rufy4 A G 1: 74,132,876 R253G probably benign Het
Scaf1 G A 7: 45,007,743 R571C unknown Het
Scn2a A T 2: 65,701,979 H645L probably damaging Het
Sec24b A G 3: 129,988,946 S1132P probably damaging Het
Slc1a2 A G 2: 102,755,945 K298R probably damaging Het
Slc25a54 T A 3: 109,107,257 N230K probably benign Het
Slc27a4 T G 2: 29,815,652 Y617* probably null Het
Slc2a10 T C 2: 165,515,349 S310P probably damaging Het
Snx33 C T 9: 56,925,867 R306H probably damaging Het
Spag9 A T 11: 94,089,432 probably null Het
Spg11 A T 2: 122,101,789 probably null Het
Sycp2l A G 13: 41,129,782 T165A probably damaging Het
Syt14 A G 1: 192,933,263 C189R probably damaging Het
Taar9 A T 10: 24,108,984 L184Q probably damaging Het
Tkt C T 14: 30,559,858 P111L probably damaging Het
Trpc1 A T 9: 95,721,144 L445Q possibly damaging Het
Usp53 A G 3: 122,949,710 S526P probably benign Het
Vps54 T G 11: 21,298,791 W447G probably damaging Het
Xirp2 A T 2: 67,509,833 H806L probably benign Het
Zfp451 A T 1: 33,802,570 H410Q unknown Het
Zfp688 A G 7: 127,419,312 C214R probably damaging Het
Zic4 A G 9: 91,379,121 D143G possibly damaging Het
Other mutations in Greb1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Greb1l APN 18 10555962 missense possibly damaging 0.90
IGL01554:Greb1l APN 18 10522144 missense probably benign 0.01
IGL01563:Greb1l APN 18 10469399 missense probably damaging 0.99
IGL01944:Greb1l APN 18 10557280 missense possibly damaging 0.91
IGL02110:Greb1l APN 18 10515271 missense probably damaging 1.00
IGL02249:Greb1l APN 18 10532961 missense probably damaging 1.00
IGL02318:Greb1l APN 18 10469388 missense possibly damaging 0.91
IGL02340:Greb1l APN 18 10515200 missense probably damaging 0.99
IGL02516:Greb1l APN 18 10537064 missense probably benign 0.31
IGL02566:Greb1l APN 18 10503299 missense probably damaging 0.99
IGL02583:Greb1l APN 18 10542362 missense probably damaging 1.00
IGL02838:Greb1l APN 18 10560430 missense probably damaging 1.00
A4554:Greb1l UTSW 18 10532862 missense possibly damaging 0.58
PIT4453001:Greb1l UTSW 18 10533031 missense probably damaging 0.98
PIT4453001:Greb1l UTSW 18 10533032 missense probably benign 0.08
R0099:Greb1l UTSW 18 10509158 missense probably damaging 1.00
R0226:Greb1l UTSW 18 10522076 intron probably benign
R0234:Greb1l UTSW 18 10560331 missense probably damaging 1.00
R0234:Greb1l UTSW 18 10560331 missense probably damaging 1.00
R0239:Greb1l UTSW 18 10458567 splice site probably benign
R0316:Greb1l UTSW 18 10547420 missense probably damaging 1.00
R0369:Greb1l UTSW 18 10469375 missense possibly damaging 0.80
R0394:Greb1l UTSW 18 10523374 missense probably damaging 0.99
R0478:Greb1l UTSW 18 10509281 missense probably damaging 1.00
R0555:Greb1l UTSW 18 10458781 splice site probably benign
R0671:Greb1l UTSW 18 10474303 missense probably damaging 1.00
R1282:Greb1l UTSW 18 10547289 missense probably benign 0.13
R1574:Greb1l UTSW 18 10554997 missense possibly damaging 0.95
R1574:Greb1l UTSW 18 10554997 missense possibly damaging 0.95
R1607:Greb1l UTSW 18 10529703 missense possibly damaging 0.85
R1666:Greb1l UTSW 18 10501080 critical splice donor site probably null
R1666:Greb1l UTSW 18 10529708 critical splice donor site probably null
R1720:Greb1l UTSW 18 10553848 missense probably benign 0.19
R1808:Greb1l UTSW 18 10542143 missense probably benign
R1829:Greb1l UTSW 18 10509314 missense probably damaging 1.00
R1897:Greb1l UTSW 18 10498992 missense probably benign 0.00
R1967:Greb1l UTSW 18 10501049 missense possibly damaging 0.91
R2025:Greb1l UTSW 18 10515221 missense possibly damaging 0.71
R2086:Greb1l UTSW 18 10523281 missense probably damaging 1.00
R2125:Greb1l UTSW 18 10511422 missense probably damaging 0.98
R2139:Greb1l UTSW 18 10555011 missense probably damaging 1.00
R2255:Greb1l UTSW 18 10554857 missense probably damaging 1.00
R2256:Greb1l UTSW 18 10503307 missense possibly damaging 0.91
R2257:Greb1l UTSW 18 10503307 missense possibly damaging 0.91
R2880:Greb1l UTSW 18 10547288 missense possibly damaging 0.93
R3623:Greb1l UTSW 18 10542380 missense probably damaging 0.99
R3778:Greb1l UTSW 18 10469444 missense possibly damaging 0.60
R3975:Greb1l UTSW 18 10522247 missense possibly damaging 0.71
R4038:Greb1l UTSW 18 10515209 missense possibly damaging 0.93
R4062:Greb1l UTSW 18 10522150 missense probably damaging 0.99
R4134:Greb1l UTSW 18 10529708 critical splice donor site probably null
R4342:Greb1l UTSW 18 10544561 missense probably benign 0.12
R4409:Greb1l UTSW 18 10503182 missense possibly damaging 0.70
R4600:Greb1l UTSW 18 10553705 missense probably damaging 1.00
R4618:Greb1l UTSW 18 10498965 missense probably benign 0.00
R4683:Greb1l UTSW 18 10529563 splice site probably null
R4686:Greb1l UTSW 18 10522112 missense probably damaging 0.98
R4707:Greb1l UTSW 18 10532922 missense probably benign 0.02
R4780:Greb1l UTSW 18 10541792 missense probably benign 0.00
R4819:Greb1l UTSW 18 10458358 missense probably damaging 1.00
R4925:Greb1l UTSW 18 10547447 missense possibly damaging 0.79
R4960:Greb1l UTSW 18 10547306 missense probably damaging 0.99
R5150:Greb1l UTSW 18 10555950 frame shift probably null
R5154:Greb1l UTSW 18 10458312 missense probably benign 0.02
R5269:Greb1l UTSW 18 10511409 missense probably benign
R5290:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5310:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5328:Greb1l UTSW 18 10553720 missense probably damaging 1.00
R5337:Greb1l UTSW 18 10509143 missense probably damaging 1.00
R5393:Greb1l UTSW 18 10458312 missense probably benign 0.02
R5402:Greb1l UTSW 18 10537169 missense probably benign 0.26
R5718:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5719:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5720:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5721:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5902:Greb1l UTSW 18 10538302 missense probably benign 0.00
R5993:Greb1l UTSW 18 10544455 missense probably benign 0.10
R6035:Greb1l UTSW 18 10501025 missense possibly damaging 0.91
R6035:Greb1l UTSW 18 10501025 missense possibly damaging 0.91
R6045:Greb1l UTSW 18 10547068 missense probably damaging 1.00
R6063:Greb1l UTSW 18 10557340 missense probably damaging 1.00
R6297:Greb1l UTSW 18 10469494 missense probably damaging 1.00
R6405:Greb1l UTSW 18 10501076 missense probably benign 0.30
R6552:Greb1l UTSW 18 10541814 missense probably benign 0.00
R6572:Greb1l UTSW 18 10522131 missense probably benign 0.07
R6575:Greb1l UTSW 18 10547347 missense possibly damaging 0.88
R6922:Greb1l UTSW 18 10547482 missense possibly damaging 0.88
R6957:Greb1l UTSW 18 10558786 missense probably benign 0.23
R6962:Greb1l UTSW 18 10547327 missense probably damaging 1.00
R7012:Greb1l UTSW 18 10529707 critical splice donor site probably null
R7251:Greb1l UTSW 18 10515319 missense probably damaging 1.00
R7275:Greb1l UTSW 18 10544561 missense probably benign 0.12
R7301:Greb1l UTSW 18 10544970 missense probably damaging 1.00
R7307:Greb1l UTSW 18 10538142 missense probably damaging 0.99
R7455:Greb1l UTSW 18 10554915 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTTGATATACCTGTTCAGGATG -3'
(R):5'- TTTGAGCCCTAGCAAGCAAG -3'

Sequencing Primer
(F):5'- ATATACCTGTTCAGGATGGTGGTGAG -3'
(R):5'- GCAAGTTTAAAAGTCAAGATGTGCC -3'
Posted On2019-06-26