Incidental Mutation 'R7179:Rrp12'
ID558878
Institutional Source Beutler Lab
Gene Symbol Rrp12
Ensembl Gene ENSMUSG00000035049
Gene Nameribosomal RNA processing 12 homolog (S. cerevisiae)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.942) question?
Stock #R7179 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location41862852-41896153 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 41883778 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 420 (T420S)
Ref Sequence ENSEMBL: ENSMUSP00000039853 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038677]
Predicted Effect probably benign
Transcript: ENSMUST00000038677
AA Change: T420S

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000039853
Gene: ENSMUSG00000035049
AA Change: T420S

DomainStartEndE-ValueType
low complexity region 164 175 N/A INTRINSIC
Pfam:NUC173 473 670 1.2e-72 PFAM
SCOP:d1qbkb_ 711 1087 2e-6 SMART
low complexity region 1157 1184 N/A INTRINSIC
low complexity region 1231 1243 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency 100% (76/76)
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot13 A T 13: 24,818,171 I96K probably benign Het
Adam6a A G 12: 113,545,671 T555A probably benign Het
Alms1 C T 6: 85,621,369 P1059L probably benign Het
Apol7c T C 15: 77,525,643 T368A probably benign Het
Arfgef3 A T 10: 18,599,267 L1557Q probably damaging Het
Baz2a C T 10: 128,124,457 R1514W probably damaging Het
Bmp3 T A 5: 98,872,763 D348E probably damaging Het
Bves A G 10: 45,354,817 S295G probably damaging Het
Carmil1 A G 13: 24,020,069 C1328R probably benign Het
Ccnk T A 12: 108,187,258 Y93N probably damaging Het
Ccr1 A T 9: 123,964,052 V147D probably damaging Het
Cd24a G A 10: 43,582,640 G36S probably benign Het
Cep104 A G 4: 153,992,867 Y569C probably damaging Het
Chd2 A T 7: 73,475,420 I884N probably damaging Het
Cnst A T 1: 179,579,382 probably benign Het
Col22a1 A G 15: 71,933,413 L146P unknown Het
Col25a1 G T 3: 130,530,119 R321L probably damaging Het
Ctnnd2 T C 15: 30,683,364 Y504H possibly damaging Het
D3Ertd751e C A 3: 41,748,708 Q73K probably damaging Het
Dsc2 C T 18: 20,035,275 probably null Het
Eya1 A T 1: 14,302,852 S14R probably damaging Het
Fam131c A T 4: 141,383,017 probably null Het
Fam71a G A 1: 191,164,021 R142C probably damaging Het
Flvcr2 T C 12: 85,747,191 F114L possibly damaging Het
Fyn A G 10: 39,532,124 D321G possibly damaging Het
Galnt5 A C 2: 57,998,609 M74L probably benign Het
Gas2l2 G A 11: 83,422,462 P675S probably benign Het
Gm9508 G T 10: 77,696,636 Q200K unknown Het
Greb1l G A 18: 10,544,576 S1390N probably benign Het
Hdac5 G T 11: 102,204,559 T430K possibly damaging Het
Hjurp TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTGCT TCT 1: 88,266,278 probably benign Het
Khnyn C T 14: 55,894,354 P578S probably damaging Het
Lepr A T 4: 101,745,659 T215S probably benign Het
Lrfn5 G A 12: 61,843,982 V686I probably benign Het
Mapkap1 T A 2: 34,518,700 H233Q possibly damaging Het
Mcm3 A G 1: 20,814,857 I201T probably damaging Het
Metrnl G A 11: 121,715,908 R263Q probably damaging Het
Mettl22 A G 16: 8,478,060 E71G probably benign Het
Muc16 T C 9: 18,642,008 T4330A probably benign Het
Mug1 A G 6: 121,857,420 T387A probably benign Het
Myh4 A G 11: 67,244,724 D379G probably benign Het
Nbas A G 12: 13,405,397 D1204G possibly damaging Het
Ncor2 T C 5: 125,055,783 K478E unknown Het
Olfr173 T A 16: 58,796,887 I320F probably benign Het
Olfr294 A T 7: 86,616,366 L93Q possibly damaging Het
Olfr557 A G 7: 102,698,270 T11A probably benign Het
Osbpl7 G A 11: 97,050,836 V62I probably benign Het
Pak1ip1 A G 13: 41,009,542 N246S probably damaging Het
Prim1 A G 10: 128,015,976 Y39C probably damaging Het
Prl3b1 G T 13: 27,243,844 V46L probably benign Het
Prss54 A T 8: 95,565,571 S127T probably benign Het
Rasal3 G A 17: 32,392,417 T912M probably damaging Het
Rspo1 A G 4: 125,005,038 N51D probably damaging Het
Rufy4 A G 1: 74,132,876 R253G probably benign Het
Scaf1 G A 7: 45,007,743 R571C unknown Het
Scn2a A T 2: 65,701,979 H645L probably damaging Het
Sec24b A G 3: 129,988,946 S1132P probably damaging Het
Slc1a2 A G 2: 102,755,945 K298R probably damaging Het
Slc25a54 T A 3: 109,107,257 N230K probably benign Het
Slc27a4 T G 2: 29,815,652 Y617* probably null Het
Slc2a10 T C 2: 165,515,349 S310P probably damaging Het
Snx33 C T 9: 56,925,867 R306H probably damaging Het
Spag9 A T 11: 94,089,432 probably null Het
Spg11 A T 2: 122,101,789 probably null Het
Sycp2l A G 13: 41,129,782 T165A probably damaging Het
Syt14 A G 1: 192,933,263 C189R probably damaging Het
Taar9 A T 10: 24,108,984 L184Q probably damaging Het
Tkt C T 14: 30,559,858 P111L probably damaging Het
Trpc1 A T 9: 95,721,144 L445Q possibly damaging Het
Usp53 A G 3: 122,949,710 S526P probably benign Het
Vps54 T G 11: 21,298,791 W447G probably damaging Het
Xirp2 A T 2: 67,509,833 H806L probably benign Het
Zfp451 A T 1: 33,802,570 H410Q unknown Het
Zfp688 A G 7: 127,419,312 C214R probably damaging Het
Zic4 A G 9: 91,379,121 D143G possibly damaging Het
Other mutations in Rrp12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Rrp12 APN 19 41887094 missense possibly damaging 0.94
IGL00430:Rrp12 APN 19 41877334 critical splice donor site probably null
IGL00496:Rrp12 APN 19 41878027 critical splice donor site probably null
IGL00953:Rrp12 APN 19 41871792 missense possibly damaging 0.51
IGL01320:Rrp12 APN 19 41877936 missense probably damaging 1.00
IGL01479:Rrp12 APN 19 41865202 missense probably benign 0.05
IGL01939:Rrp12 APN 19 41870895 missense probably damaging 0.99
IGL02147:Rrp12 APN 19 41886181 missense probably damaging 1.00
IGL02255:Rrp12 APN 19 41872971 missense probably damaging 1.00
IGL02756:Rrp12 APN 19 41896061 missense probably benign 0.03
IGL02793:Rrp12 APN 19 41871566 missense probably damaging 1.00
IGL03026:Rrp12 APN 19 41872997 missense probably damaging 1.00
IGL03202:Rrp12 APN 19 41868766 splice site probably null
IGL03393:Rrp12 APN 19 41871793 missense possibly damaging 0.91
R0137:Rrp12 UTSW 19 41873850 missense probably benign
R0234:Rrp12 UTSW 19 41871760 missense probably damaging 1.00
R0234:Rrp12 UTSW 19 41871760 missense probably damaging 1.00
R0522:Rrp12 UTSW 19 41874705 splice site probably benign
R0616:Rrp12 UTSW 19 41892549 missense possibly damaging 0.95
R1509:Rrp12 UTSW 19 41882200 missense probably damaging 1.00
R1537:Rrp12 UTSW 19 41886803 missense probably damaging 0.97
R1593:Rrp12 UTSW 19 41863241 missense probably benign 0.00
R1635:Rrp12 UTSW 19 41868785 missense probably benign 0.00
R1642:Rrp12 UTSW 19 41871737 missense probably damaging 1.00
R1696:Rrp12 UTSW 19 41873749 missense probably damaging 1.00
R1827:Rrp12 UTSW 19 41880481 missense possibly damaging 0.95
R1844:Rrp12 UTSW 19 41877783 critical splice donor site probably null
R1950:Rrp12 UTSW 19 41892590 missense probably damaging 1.00
R2010:Rrp12 UTSW 19 41872937 missense probably benign
R2115:Rrp12 UTSW 19 41891094 missense probably benign 0.38
R2136:Rrp12 UTSW 19 41892599 missense probably damaging 1.00
R2386:Rrp12 UTSW 19 41871284 missense probably benign 0.41
R3741:Rrp12 UTSW 19 41885728 missense probably damaging 1.00
R4096:Rrp12 UTSW 19 41887148 missense probably benign 0.32
R4292:Rrp12 UTSW 19 41872905 splice site probably null
R4407:Rrp12 UTSW 19 41892551 missense probably damaging 1.00
R4629:Rrp12 UTSW 19 41883516 missense probably benign 0.03
R4698:Rrp12 UTSW 19 41873042 missense probably benign 0.12
R4702:Rrp12 UTSW 19 41871536 missense probably damaging 1.00
R4716:Rrp12 UTSW 19 41877428 missense probably damaging 1.00
R4837:Rrp12 UTSW 19 41877505 splice site probably null
R5282:Rrp12 UTSW 19 41876590 missense probably benign
R5327:Rrp12 UTSW 19 41892596 missense probably damaging 1.00
R5621:Rrp12 UTSW 19 41880417 missense probably benign
R5762:Rrp12 UTSW 19 41880152 missense possibly damaging 0.88
R5947:Rrp12 UTSW 19 41870808 critical splice donor site probably null
R6213:Rrp12 UTSW 19 41868778 missense probably benign
R6407:Rrp12 UTSW 19 41883742 missense probably damaging 0.98
R6980:Rrp12 UTSW 19 41890143 missense probably damaging 0.98
R7186:Rrp12 UTSW 19 41871305 critical splice acceptor site probably null
R7194:Rrp12 UTSW 19 41871540 missense probably benign
R7206:Rrp12 UTSW 19 41878039 missense probably damaging 1.00
R7209:Rrp12 UTSW 19 41872949 missense possibly damaging 0.62
R7248:Rrp12 UTSW 19 41883438 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TTTCCAAGTTCTAAAAGCCTGTCTC -3'
(R):5'- CTGCAGGCCAGTAGATGTTTTC -3'

Sequencing Primer
(F):5'- TGTCTCCCACAGTGAGAAGCTC -3'
(R):5'- CAGGCCAGTAGATGTTTTCACCTG -3'
Posted On2019-06-26