Incidental Mutation 'R7180:Zfp628'
ID558909
Institutional Source Beutler Lab
Gene Symbol Zfp628
Ensembl Gene ENSMUSG00000074406
Gene Namezinc finger protein 628
SynonymsZec
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.443) question?
Stock #R7180 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location4915217-4922002 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 4921064 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 762 (Q762K)
Ref Sequence ENSEMBL: ENSMUSP00000112058 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047309] [ENSMUST00000057612] [ENSMUST00000116354] [ENSMUST00000207506] [ENSMUST00000207527] [ENSMUST00000207687] [ENSMUST00000208754]
Predicted Effect probably benign
Transcript: ENSMUST00000047309
SMART Domains Protein: ENSMUSP00000045354
Gene: ENSMUSG00000035285

DomainStartEndE-ValueType
low complexity region 35 51 N/A INTRINSIC
transmembrane domain 55 77 N/A INTRINSIC
low complexity region 88 97 N/A INTRINSIC
Pfam:Acetyltransf_1 101 186 4.1e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000057612
SMART Domains Protein: ENSMUSP00000052126
Gene: ENSMUSG00000035279

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
SR 20 120 4.44e-49 SMART
low complexity region 141 155 N/A INTRINSIC
low complexity region 167 182 N/A INTRINSIC
SR 199 299 2.36e-53 SMART
SR 305 405 8.22e-53 SMART
low complexity region 437 462 N/A INTRINSIC
SR 464 565 1.11e-49 SMART
low complexity region 741 755 N/A INTRINSIC
SR 758 858 3.93e-50 SMART
low complexity region 936 957 N/A INTRINSIC
low complexity region 981 1004 N/A INTRINSIC
low complexity region 1018 1035 N/A INTRINSIC
low complexity region 1218 1230 N/A INTRINSIC
low complexity region 1357 1364 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000116354
AA Change: Q762K

PolyPhen 2 Score 0.176 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000112058
Gene: ENSMUSG00000074406
AA Change: Q762K

DomainStartEndE-ValueType
low complexity region 13 32 N/A INTRINSIC
ZnF_C2H2 34 56 1.04e-3 SMART
ZnF_C2H2 62 84 2.4e-3 SMART
ZnF_C2H2 90 112 2.09e-3 SMART
ZnF_C2H2 118 140 1.56e-2 SMART
ZnF_C2H2 146 168 3.69e-4 SMART
ZnF_C2H2 174 196 7.49e-5 SMART
ZnF_C2H2 202 224 1.69e-3 SMART
low complexity region 225 238 N/A INTRINSIC
low complexity region 255 275 N/A INTRINSIC
ZnF_C2H2 289 309 1.38e2 SMART
low complexity region 334 344 N/A INTRINSIC
ZnF_C2H2 346 368 1.76e-1 SMART
ZnF_C2H2 376 398 9.3e-1 SMART
low complexity region 422 440 N/A INTRINSIC
ZnF_C2H2 446 468 2.75e-3 SMART
ZnF_C2H2 474 496 1.69e-3 SMART
ZnF_C2H2 502 524 1.45e-2 SMART
ZnF_C2H2 530 552 1.03e-2 SMART
ZnF_C2H2 558 580 3.44e-4 SMART
ZnF_C2H2 586 608 2.61e-4 SMART
ZnF_C2H2 614 636 7.9e-4 SMART
low complexity region 685 703 N/A INTRINSIC
low complexity region 716 756 N/A INTRINSIC
low complexity region 770 792 N/A INTRINSIC
low complexity region 981 1000 N/A INTRINSIC
low complexity region 1001 1018 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207506
Predicted Effect probably benign
Transcript: ENSMUST00000207527
Predicted Effect probably benign
Transcript: ENSMUST00000207687
Predicted Effect probably benign
Transcript: ENSMUST00000208754
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Zinc finger proteins (ZNFs), which bind nucleic acids, perform many key functions, the most important of which is regulating transcription. See ZNF91 (MIM 603971) for general information on ZNFs.[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acnat2 A C 4: 49,381,803 Y196* probably null Het
Agrn C T 4: 156,171,839 R1405H probably benign Het
Agtpbp1 G A 13: 59,466,038 H1030Y probably benign Het
Ankrd37 C T 8: 45,999,854 probably benign Het
Ap1g2 G C 14: 55,104,451 P218R probably damaging Het
Ap2a1 C T 7: 44,923,804 probably null Het
Apc2 T A 10: 80,311,156 D681E possibly damaging Het
Arhgef5 T A 6: 43,275,208 N964K possibly damaging Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
Ccnf T A 17: 24,223,915 M773L probably benign Het
Ces1e A C 8: 93,215,144 S234A probably damaging Het
Ces1g T A 8: 93,302,948 E552V probably benign Het
Ctcfl A T 2: 173,105,977 probably null Het
Dkk2 T A 3: 132,086,192 S54T probably damaging Het
Dll1 A G 17: 15,374,869 S49P probably benign Het
Dscam C A 16: 96,825,564 A382S probably damaging Het
Eif5b A T 1: 38,049,074 M1020L probably damaging Het
Enpp4 T C 17: 44,102,037 D202G probably benign Het
Eps8 A T 6: 137,479,074 I803N possibly damaging Het
Etv2 C A 7: 30,635,649 G28V probably damaging Het
Fadd A T 7: 144,580,785 V121E probably damaging Het
Fam149b T C 14: 20,381,785 Y545H probably benign Het
Fam196b A G 11: 34,419,873 K526E probably damaging Het
Fbxl21 A T 13: 56,523,527 M1L probably benign Het
Flg2 T C 3: 93,202,833 S723P unknown Het
Gm4884 C T 7: 41,044,209 T534I possibly damaging Het
Gm8994 T A 6: 136,329,537 I332N probably damaging Het
Gpbar1 A T 1: 74,278,633 I12F possibly damaging Het
Gpr151 A T 18: 42,578,956 L219* probably null Het
Hdgfl2 T A 17: 56,097,532 probably null Het
Hectd4 A G 5: 121,308,342 M200V probably benign Het
Idua A G 5: 108,680,895 N335S probably benign Het
Ifit1bl1 A T 19: 34,593,902 F385Y probably damaging Het
Ift172 T C 5: 31,254,262 D1624G probably damaging Het
Igsf9b A T 9: 27,322,668 T388S possibly damaging Het
Ikbkap A T 4: 56,796,535 S118R probably damaging Het
Jak2 A G 19: 29,282,411 I237V probably benign Het
Kat5 C A 19: 5,603,961 K398N probably damaging Het
Lmbrd2 T A 15: 9,175,196 V398E possibly damaging Het
Lrp1 T C 10: 127,556,965 N2744D probably damaging Het
Lrrd1 T C 5: 3,851,459 I588T probably damaging Het
Ltn1 A G 16: 87,418,494 F418L probably damaging Het
Magi1 T A 6: 93,815,750 D169V probably benign Het
Mpdz T C 4: 81,335,751 E1048G probably damaging Het
Myh9 T C 15: 77,807,910 I150V probably benign Het
Nckap1 A T 2: 80,506,892 M1006K probably benign Het
Nkain1 C T 4: 130,533,925 V132I probably benign Het
Npy6r A T 18: 44,276,156 M215L probably benign Het
Nr3c2 A T 8: 76,908,963 Q231L probably damaging Het
Obox5 C T 7: 15,757,924 P88L probably benign Het
Olfr514 A G 7: 108,825,979 S7P probably damaging Het
Olfr827 T C 10: 130,210,942 T63A probably benign Het
P2rx7 A G 5: 122,680,820 D435G possibly damaging Het
Pdzd2 T A 15: 12,376,123 S1309C probably damaging Het
Pex5l C T 3: 33,024,691 probably null Het
Pip T A 6: 41,847,631 C18S probably damaging Het
Pla2g7 C T 17: 43,599,076 T157M probably damaging Het
Plce1 A G 19: 38,779,785 Y2168C probably damaging Het
Rgs2 T C 1: 144,002,148 T137A probably benign Het
Rpl32 T A 6: 115,807,807 I31F possibly damaging Het
Ryr2 T C 13: 11,686,978 Y2931C probably damaging Het
Slc4a4 G A 5: 89,046,236 E192K probably damaging Het
Slc4a7 G A 14: 14,765,580 A521T probably damaging Het
Smchd1 T C 17: 71,394,823 E1058G probably damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Ssc5d A G 7: 4,936,601 T679A probably benign Het
Tas2r130 A C 6: 131,630,248 S195A probably benign Het
Tas2r135 C T 6: 42,405,751 R75* probably null Het
Terf2ip G T 8: 112,011,420 probably benign Het
Tm6sf2 G A 8: 70,076,006 R136K probably benign Het
Tmprss15 A G 16: 78,967,998 L858P probably damaging Het
Topaz1 A G 9: 122,797,705 D1466G possibly damaging Het
Trip4 A T 9: 65,857,345 L446Q probably damaging Het
Trpv3 G T 11: 73,277,992 V93L probably benign Het
Ubl4b A T 3: 107,554,646 H99Q probably damaging Het
Unc45a A T 7: 80,329,821 probably null Het
Vmn1r47 G T 6: 90,022,353 A156S probably damaging Het
Vmn2r33 T A 7: 7,563,897 H72L probably benign Het
Zeb1 G A 18: 5,767,867 V793M possibly damaging Het
Other mutations in Zfp628
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00849:Zfp628 APN 7 4920806 missense probably damaging 1.00
R0107:Zfp628 UTSW 7 4920168 missense probably damaging 1.00
R0110:Zfp628 UTSW 7 4919733 missense probably benign
R0450:Zfp628 UTSW 7 4919733 missense probably benign
R0469:Zfp628 UTSW 7 4919733 missense probably benign
R0480:Zfp628 UTSW 7 4921616 missense probably benign 0.00
R0518:Zfp628 UTSW 7 4919940 missense probably damaging 0.97
R0521:Zfp628 UTSW 7 4919940 missense probably damaging 0.97
R1081:Zfp628 UTSW 7 4920183 missense probably damaging 1.00
R1846:Zfp628 UTSW 7 4920867 missense possibly damaging 0.52
R1938:Zfp628 UTSW 7 4920768 missense probably benign 0.00
R1997:Zfp628 UTSW 7 4918832 missense probably damaging 0.98
R2221:Zfp628 UTSW 7 4920831 missense probably benign 0.00
R2364:Zfp628 UTSW 7 4920687 missense probably damaging 1.00
R3077:Zfp628 UTSW 7 4921200 missense possibly damaging 0.88
R3964:Zfp628 UTSW 7 4921745 missense probably benign 0.00
R3966:Zfp628 UTSW 7 4921745 missense probably benign 0.00
R6058:Zfp628 UTSW 7 4920918 missense probably damaging 1.00
R6240:Zfp628 UTSW 7 4919849 missense possibly damaging 0.93
R6516:Zfp628 UTSW 7 4920202 nonsense probably null
R6962:Zfp628 UTSW 7 4919550 missense probably benign 0.03
R7347:Zfp628 UTSW 7 4921818 missense probably damaging 0.99
R7348:Zfp628 UTSW 7 4921818 missense probably damaging 0.99
R7349:Zfp628 UTSW 7 4921818 missense probably damaging 0.99
X0022:Zfp628 UTSW 7 4919409 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGCTCCCAGTTCTCAAAC -3'
(R):5'- CTGGACTGTAGTCACTTCCTGTG -3'

Sequencing Primer
(F):5'- GTTCTCAAACATTTCTCCTGGTACAG -3'
(R):5'- CTGTAGTTGTACCGTGGCCAC -3'
Posted On2019-06-26