Incidental Mutation 'R7181:Ptprb'
ID558989
Institutional Source Beutler Lab
Gene Symbol Ptprb
Ensembl Gene ENSMUSG00000020154
Gene Nameprotein tyrosine phosphatase, receptor type, B
Synonyms3230402H02Rik, VE-PTP
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7181 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location116275523-116389535 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 116368766 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 1835 (S1835L)
Ref Sequence ENSEMBL: ENSMUSP00000089805 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092167] [ENSMUST00000218553]
Predicted Effect probably damaging
Transcript: ENSMUST00000092167
AA Change: S1835L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000089805
Gene: ENSMUSG00000020154
AA Change: S1835L

DomainStartEndE-ValueType
FN3 22 102 8.23e1 SMART
FN3 111 193 1.73e-5 SMART
FN3 204 281 1.56e-3 SMART
FN3 290 366 6.45e-5 SMART
FN3 378 459 5e-2 SMART
FN3 468 546 1.61e-5 SMART
FN3 555 632 7.18e-3 SMART
FN3 644 724 7.52e-6 SMART
FN3 732 811 2.92e-3 SMART
FN3 820 899 2.76e-4 SMART
FN3 908 987 1.29e-4 SMART
FN3 996 1075 7.7e-3 SMART
FN3 1086 1166 1.21e0 SMART
FN3 1174 1253 5.08e-3 SMART
FN3 1262 1340 1.17e-7 SMART
FN3 1356 1435 2.68e-2 SMART
Blast:FN3 1450 1591 6e-88 BLAST
transmembrane domain 1620 1642 N/A INTRINSIC
Blast:PTPc 1643 1681 3e-11 BLAST
PTPc 1703 1966 1.05e-134 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000218553
AA Change: S2122L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.156 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an extracellular domain, a single transmembrane segment and one intracytoplasmic catalytic domain, thus belongs to receptor type PTP. The extracellular region of this PTP is composed of multiple fibronectin type_III repeats, which was shown to interact with neuronal receptor and cell adhesion molecules, such as contactin and tenascin C. This protein was also found to interact with sodium channels, and thus may regulate sodium channels by altering tyrosine phosphorylation status. The functions of the interaction partners of this protein implicate the roles of this PTP in cell adhesion, neurite growth, and neuronal differentiation. Alternate transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality at E10, impaired vascular maintenace and remodeling, heart defects and abnormal yolk sac vasculature. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A G 17: 56,881,037 N182D probably benign Het
Adgrl1 A G 8: 83,926,249 probably null Het
Adm T C 7: 110,629,029 I139T probably damaging Het
Ahnak A T 19: 9,013,488 K4045N probably damaging Het
Axin1 T A 17: 26,173,778 S344R probably damaging Het
Cacna1g T C 11: 94,415,865 S1896G probably benign Het
Cd209c A G 8: 3,945,712 V30A probably benign Het
Cd86 CA CAA 16: 36,606,555 probably null Het
Cdh8 A T 8: 99,098,925 M520K probably benign Het
Cyp2b23 G A 7: 26,674,403 T306I probably damaging Het
Dnajc10 T G 2: 80,319,243 Y96* probably null Het
Elmod1 A C 9: 53,934,098 probably null Het
Eva1b A G 4: 126,149,653 H162R possibly damaging Het
Fam222b A T 11: 78,154,978 N455I probably damaging Het
Fer1l6 G A 15: 58,575,297 A626T probably benign Het
Fgd6 A G 10: 94,043,511 T76A probably benign Het
Fndc7 A G 3: 108,881,324 probably null Het
Gabrg2 T A 11: 41,920,434 I295F probably damaging Het
Gm10406 A T 14: 7,027,359 probably null Het
Gm2035 G A 12: 87,919,722 R46W possibly damaging Het
Gm47189 T C 14: 41,770,102 M73V probably benign Het
Gm9758 A T 5: 14,913,653 S54T probably damaging Het
Gm9857 A G 3: 108,940,238 S70P unknown Het
Gsap A T 5: 21,253,429 E470D probably damaging Het
Hesx1 T A 14: 27,000,721 M1K probably null Het
Hirip3 A G 7: 126,864,063 D397G probably damaging Het
Kalrn T A 16: 34,163,077 N13I probably benign Het
Mettl8 A T 2: 70,973,362 S194T possibly damaging Het
Mrps35 T G 6: 147,055,993 probably null Het
Myrfl G T 10: 116,861,543 N25K probably damaging Het
Olfr57 A G 10: 79,035,453 Y219C probably damaging Het
Olfr623 C A 7: 103,660,813 G146C probably damaging Het
Olfr826 A T 10: 130,180,757 I41N possibly damaging Het
Phf14 A T 6: 11,933,341 E67D unknown Het
Prdm16 C T 4: 154,528,637 G111D probably damaging Het
Prex1 G A 2: 166,570,371 A1568V probably damaging Het
Ptpn23 G A 9: 110,385,257 T1692I unknown Het
Rbm19 G A 5: 120,116,467 probably benign Het
Rgs7bp T A 13: 104,982,874 H152L possibly damaging Het
Rmdn3 A T 2: 119,139,368 L404Q probably damaging Het
Rock2 T A 12: 16,973,143 F1148I probably benign Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Sec24c C A 14: 20,689,333 H559N probably damaging Het
Sephs2 T C 7: 127,273,820 S34G probably benign Het
Serpina6 A T 12: 103,646,944 S366T probably benign Het
Serpinb7 A T 1: 107,450,322 E248D probably benign Het
Sesn1 G T 10: 41,903,728 R386L possibly damaging Het
Skida1 T C 2: 18,046,791 S430G unknown Het
Slc28a2 A T 2: 122,451,981 probably null Het
Slc39a8 T C 3: 135,857,538 F203S possibly damaging Het
Svip A G 7: 52,003,429 S46P possibly damaging Het
Tbx21 T A 11: 97,099,097 D423V probably benign Het
Tcirg1 G A 19: 3,903,576 A117V probably null Het
Tmem63b T A 17: 45,673,168 K258N probably benign Het
Tmem94 A G 11: 115,794,774 N951S probably damaging Het
Uba2 G T 7: 34,141,429 D591E probably benign Het
Unc13b C T 4: 43,258,893 R1356W probably damaging Het
Wasf3 A G 5: 146,466,805 T242A probably benign Het
Wscd1 T C 11: 71,759,883 L12P probably damaging Het
Zfp770 T C 2: 114,197,391 K66E probably damaging Het
Zfyve26 A T 12: 79,268,408 D1431E probably benign Het
Zhx2 G A 15: 57,823,350 R705H probably benign Het
Other mutations in Ptprb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Ptprb APN 10 116362648 missense probably benign 0.15
IGL01354:Ptprb APN 10 116343891 missense probably benign 0.24
IGL01404:Ptprb APN 10 116339436 missense probably benign 0.14
IGL01410:Ptprb APN 10 116302274 missense possibly damaging 0.60
IGL01412:Ptprb APN 10 116343915 missense probably benign 0.27
IGL01731:Ptprb APN 10 116372876 missense probably damaging 1.00
IGL02003:Ptprb APN 10 116367505 missense probably damaging 1.00
IGL02110:Ptprb APN 10 116331203 splice site probably benign
IGL02178:Ptprb APN 10 116322532 missense probably benign 0.00
IGL02304:Ptprb APN 10 116331259 missense probably damaging 1.00
IGL02324:Ptprb APN 10 116319333 missense probably benign 0.03
IGL02388:Ptprb APN 10 116367521 missense probably damaging 1.00
IGL02640:Ptprb APN 10 116338664 missense probably damaging 0.99
IGL02698:Ptprb APN 10 116363280 missense probably benign 0.05
IGL02876:Ptprb APN 10 116348211 splice site probably benign
IGL02879:Ptprb APN 10 116327968 missense probably benign
IGL02982:Ptprb APN 10 116322628 missense probably benign 0.20
IGL03146:Ptprb APN 10 116328127 missense probably benign 0.14
IGL03351:Ptprb APN 10 116339582 missense probably benign 0.03
R0306:Ptprb UTSW 10 116343988 missense probably benign 0.04
R0385:Ptprb UTSW 10 116350178 missense probably benign 0.00
R0600:Ptprb UTSW 10 116368807 missense possibly damaging 0.63
R0613:Ptprb UTSW 10 116302325 missense possibly damaging 0.59
R0613:Ptprb UTSW 10 116302378 missense possibly damaging 0.87
R0850:Ptprb UTSW 10 116302125 missense possibly damaging 0.87
R0850:Ptprb UTSW 10 116339510 missense probably damaging 1.00
R1331:Ptprb UTSW 10 116367532 missense probably damaging 1.00
R1413:Ptprb UTSW 10 116339679 missense probably damaging 1.00
R1418:Ptprb UTSW 10 116319470 missense probably benign 0.00
R1545:Ptprb UTSW 10 116380869 missense probably damaging 1.00
R1562:Ptprb UTSW 10 116339467 missense probably benign 0.00
R1752:Ptprb UTSW 10 116340990 missense probably benign 0.44
R1837:Ptprb UTSW 10 116341626 missense probably benign 0.00
R1940:Ptprb UTSW 10 116319610 splice site probably benign
R1958:Ptprb UTSW 10 116341536 missense probably benign 0.10
R2029:Ptprb UTSW 10 116347053 missense probably benign 0.37
R2031:Ptprb UTSW 10 116317543 missense probably benign
R2101:Ptprb UTSW 10 116315038 splice site probably benign
R2209:Ptprb UTSW 10 116369357 missense probably damaging 1.00
R3016:Ptprb UTSW 10 116357295 missense possibly damaging 0.64
R3076:Ptprb UTSW 10 116344026 missense probably damaging 0.99
R3821:Ptprb UTSW 10 116350074 missense probably benign 0.11
R3824:Ptprb UTSW 10 116350789 missense probably benign 0.05
R3825:Ptprb UTSW 10 116350789 missense probably benign 0.05
R3841:Ptprb UTSW 10 116346982 missense possibly damaging 0.79
R3953:Ptprb UTSW 10 116341494 missense probably benign 0.00
R4125:Ptprb UTSW 10 116353849 missense probably benign 0.12
R4227:Ptprb UTSW 10 116302225 missense possibly damaging 0.96
R4385:Ptprb UTSW 10 116346867 missense probably benign
R4731:Ptprb UTSW 10 116319333 missense probably benign 0.03
R5009:Ptprb UTSW 10 116348127 missense possibly damaging 0.61
R5104:Ptprb UTSW 10 116322459 missense probably benign 0.17
R5114:Ptprb UTSW 10 116348183 missense possibly damaging 0.59
R5145:Ptprb UTSW 10 116343915 missense probably benign 0.27
R5214:Ptprb UTSW 10 116369324 missense possibly damaging 0.75
R5382:Ptprb UTSW 10 116353871 missense probably damaging 1.00
R5553:Ptprb UTSW 10 116350185 missense probably damaging 1.00
R5585:Ptprb UTSW 10 116380854 missense probably damaging 0.98
R5586:Ptprb UTSW 10 116353827 missense probably damaging 1.00
R5808:Ptprb UTSW 10 116339487 missense probably benign 0.00
R5875:Ptprb UTSW 10 116348166 missense probably benign 0.00
R6051:Ptprb UTSW 10 116341090 nonsense probably null
R6383:Ptprb UTSW 10 116347007 nonsense probably null
R6511:Ptprb UTSW 10 116346820 missense probably damaging 1.00
R6817:Ptprb UTSW 10 116283677 small deletion probably benign
R6826:Ptprb UTSW 10 116317372 missense probably benign 0.26
R6958:Ptprb UTSW 10 116277248 missense probably benign 0.32
R7103:Ptprb UTSW 10 116338813 missense probably damaging 1.00
R7129:Ptprb UTSW 10 116283677 small deletion probably benign
R7215:Ptprb UTSW 10 116338776 missense possibly damaging 0.94
R7289:Ptprb UTSW 10 116328165 missense probably damaging 0.99
R7315:Ptprb UTSW 10 116362379 missense possibly damaging 0.83
R7319:Ptprb UTSW 10 116341404 missense probably benign 0.01
R7381:Ptprb UTSW 10 116341133 missense probably benign
R7412:Ptprb UTSW 10 116341138 missense probably benign
R7483:Ptprb UTSW 10 116283429 missense probably benign 0.01
X0020:Ptprb UTSW 10 116302180 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- ACAGCCATGTTGTCTTAGCAG -3'
(R):5'- AAGCCCCTTCTTTGTAAGTTGG -3'

Sequencing Primer
(F):5'- AGTTGGGCTGGCTCCCTAAC -3'
(R):5'- ACTCTCTAGGTATTCGAGGACTGAC -3'
Posted On2019-06-26