Incidental Mutation 'R7181:Tcirg1'
ID559015
Institutional Source Beutler Lab
Gene Symbol Tcirg1
Ensembl Gene ENSMUSG00000001750
Gene NameT cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 protein A3
SynonymsAtp6i, V-ATPase a3, ATP6a3, TIRC7, OC-116
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.482) question?
Stock #R7181 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location3896050-3907133 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 3903576 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 117 (A117V)
Ref Sequence ENSEMBL: ENSMUSP00000001801 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001801] [ENSMUST00000122885] [ENSMUST00000126070] [ENSMUST00000135070] [ENSMUST00000145791]
Predicted Effect probably null
Transcript: ENSMUST00000001801
AA Change: A117V

PolyPhen 2 Score 0.559 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000001801
Gene: ENSMUSG00000001750
AA Change: A117V

DomainStartEndE-ValueType
Pfam:V_ATPase_I 26 830 4.4e-287 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122885
SMART Domains Protein: ENSMUSP00000114768
Gene: ENSMUSG00000001750

DomainStartEndE-ValueType
Pfam:V_ATPase_I 1 91 2.9e-44 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000126070
AA Change: A117V

PolyPhen 2 Score 0.559 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000120531
Gene: ENSMUSG00000001750
AA Change: A117V

DomainStartEndE-ValueType
Pfam:V_ATPase_I 27 829 1.2e-277 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132164
SMART Domains Protein: ENSMUSP00000120968
Gene: ENSMUSG00000001750

DomainStartEndE-ValueType
Pfam:V_ATPase_I 1 190 4.5e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135070
SMART Domains Protein: ENSMUSP00000121241
Gene: ENSMUSG00000001750

DomainStartEndE-ValueType
low complexity region 59 70 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000145791
AA Change: A117V

PolyPhen 2 Score 0.559 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000122474
Gene: ENSMUSG00000001750
AA Change: A117V

DomainStartEndE-ValueType
Pfam:V_ATPase_I 26 830 4.4e-287 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Through alternate splicing, this gene encodes two proteins with similarity to subunits of the vacuolar ATPase (V-ATPase) but the encoded proteins seem to have different functions. V-ATPase is a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, and receptor-mediated endocytosis. V-ATPase is comprised of a cytosolic V1 domain and a transmembrane V0 domain. Mutations in this gene are associated with infantile malignant osteopetrosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for mutant alleles exhibit severe osteopetrosis with increased bone density due to failure of secondary bone resorption. Mutants lack teeth and die around 30-40 days of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A G 17: 56,881,037 N182D probably benign Het
Adm T C 7: 110,629,029 I139T probably damaging Het
Ahnak A T 19: 9,013,488 K4045N probably damaging Het
Axin1 T A 17: 26,173,778 S344R probably damaging Het
Cacna1g T C 11: 94,415,865 S1896G probably benign Het
Cd209c A G 8: 3,945,712 V30A probably benign Het
Cd86 CA CAA 16: 36,606,555 probably null Het
Cdh8 A T 8: 99,098,925 M520K probably benign Het
Cyp2b23 G A 7: 26,674,403 T306I probably damaging Het
Dnajc10 T G 2: 80,319,243 Y96* probably null Het
Eva1b A G 4: 126,149,653 H162R possibly damaging Het
Fam222b A T 11: 78,154,978 N455I probably damaging Het
Fer1l6 G A 15: 58,575,297 A626T probably benign Het
Fgd6 A G 10: 94,043,511 T76A probably benign Het
Fndc7 A G 3: 108,881,324 probably null Het
Gabrg2 T A 11: 41,920,434 I295F probably damaging Het
Gm2035 G A 12: 87,919,722 R46W possibly damaging Het
Gm47189 T C 14: 41,770,102 M73V probably benign Het
Gm9758 A T 5: 14,913,653 S54T probably damaging Het
Gm9857 A G 3: 108,940,238 S70P unknown Het
Gsap A T 5: 21,253,429 E470D probably damaging Het
Hesx1 T A 14: 27,000,721 M1K probably null Het
Hirip3 A G 7: 126,864,063 D397G probably damaging Het
Kalrn T A 16: 34,163,077 N13I probably benign Het
Mettl8 A T 2: 70,973,362 S194T possibly damaging Het
Mrps35 T G 6: 147,055,993 probably null Het
Myrfl G T 10: 116,861,543 N25K probably damaging Het
Olfr57 A G 10: 79,035,453 Y219C probably damaging Het
Olfr623 C A 7: 103,660,813 G146C probably damaging Het
Olfr826 A T 10: 130,180,757 I41N possibly damaging Het
Otx2 TCTGCTGCTGCTGCTGCTG TCTGCTGCTGCTGCTG 14: 48,659,272 probably benign Het
Phf14 A T 6: 11,933,341 E67D unknown Het
Prdm16 C T 4: 154,528,637 G111D probably damaging Het
Prex1 G A 2: 166,570,371 A1568V probably damaging Het
Ptpn23 G A 9: 110,385,257 T1692I unknown Het
Ptprb C T 10: 116,368,766 S1835L probably damaging Het
Rbm19 G A 5: 120,116,467 probably benign Het
Rgs7bp T A 13: 104,982,874 H152L possibly damaging Het
Rmdn3 A T 2: 119,139,368 L404Q probably damaging Het
Rock2 T A 12: 16,973,143 F1148I probably benign Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Sec24c C A 14: 20,689,333 H559N probably damaging Het
Sephs2 T C 7: 127,273,820 S34G probably benign Het
Serpina6 A T 12: 103,646,944 S366T probably benign Het
Serpinb7 A T 1: 107,450,322 E248D probably benign Het
Sesn1 G T 10: 41,903,728 R386L possibly damaging Het
Skida1 T C 2: 18,046,791 S430G unknown Het
Slc28a2 A T 2: 122,451,981 probably null Het
Slc39a8 T C 3: 135,857,538 F203S possibly damaging Het
Svip A G 7: 52,003,429 S46P possibly damaging Het
Tbx21 T A 11: 97,099,097 D423V probably benign Het
Tmem63b T A 17: 45,673,168 K258N probably benign Het
Tmem94 A G 11: 115,794,774 N951S probably damaging Het
Uba2 G T 7: 34,141,429 D591E probably benign Het
Unc13b C T 4: 43,258,893 R1356W probably damaging Het
Wasf3 A G 5: 146,466,805 T242A probably benign Het
Wscd1 T C 11: 71,759,883 L12P probably damaging Het
Zfp770 T C 2: 114,197,391 K66E probably damaging Het
Zfyve26 A T 12: 79,268,408 D1431E probably benign Het
Zhx2 G A 15: 57,823,350 R705H probably benign Het
Other mutations in Tcirg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00488:Tcirg1 APN 19 3899108 missense possibly damaging 0.94
IGL01735:Tcirg1 APN 19 3904210 splice site probably benign
IGL03143:Tcirg1 APN 19 3898811 missense probably damaging 1.00
R0732:Tcirg1 UTSW 19 3897866 missense possibly damaging 0.56
R1131:Tcirg1 UTSW 19 3896301 missense probably damaging 1.00
R1223:Tcirg1 UTSW 19 3898733 missense probably benign 0.01
R1548:Tcirg1 UTSW 19 3896845 missense probably benign 0.03
R1867:Tcirg1 UTSW 19 3898835 missense probably damaging 1.00
R1926:Tcirg1 UTSW 19 3902843 intron probably benign
R2262:Tcirg1 UTSW 19 3903591 missense possibly damaging 0.89
R4367:Tcirg1 UTSW 19 3899069 missense probably damaging 1.00
R5327:Tcirg1 UTSW 19 3902342 critical splice donor site probably null
R5417:Tcirg1 UTSW 19 3903509 splice site probably null
R5551:Tcirg1 UTSW 19 3898858 missense probably damaging 1.00
R5930:Tcirg1 UTSW 19 3902424 missense possibly damaging 0.95
R6026:Tcirg1 UTSW 19 3897487 missense probably benign
R6517:Tcirg1 UTSW 19 3901933 missense probably damaging 1.00
R7039:Tcirg1 UTSW 19 3896666 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTGTCTCAGAGAAGGGTCC -3'
(R):5'- ATGAGCTGGCATAACCCTGTG -3'

Sequencing Primer
(F):5'- AAGGGTCCTTCAGTATGGTCAGC -3'
(R):5'- GGCATAACCCTGTGTGACTTC -3'
Posted On2019-06-26