Incidental Mutation 'R7182:Mfsd2b'
ID559065
Institutional Source Beutler Lab
Gene Symbol Mfsd2b
Ensembl Gene ENSMUSG00000037336
Gene Namemajor facilitator superfamily domain containing 2B
SynonymsGm1964
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7182 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location4862440-4874359 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 4866157 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000045315 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045921] [ENSMUST00000085790] [ENSMUST00000137337] [ENSMUST00000147241]
Predicted Effect probably null
Transcript: ENSMUST00000045921
SMART Domains Protein: ENSMUSP00000045315
Gene: ENSMUSG00000037336

DomainStartEndE-ValueType
Pfam:MFS_2 33 472 4.6e-74 PFAM
low complexity region 476 490 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085790
SMART Domains Protein: ENSMUSP00000082945
Gene: ENSMUSG00000037336

DomainStartEndE-ValueType
Pfam:MFS_2 32 346 2.2e-56 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000137337
SMART Domains Protein: ENSMUSP00000117057
Gene: ENSMUSG00000037336

DomainStartEndE-ValueType
Pfam:MFS_2 1 368 1.1e-59 PFAM
low complexity region 373 387 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147241
SMART Domains Protein: ENSMUSP00000114977
Gene: ENSMUSG00000037336

DomainStartEndE-ValueType
Pfam:MFS_2 33 110 3.1e-13 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 96% (70/73)
MGI Phenotype PHENOTYPE: Homozygous KO reduces sphingosine-1-phosphate export from, and increases its accumulation in, red blood cells and platelets, and leads to reduced leukocyte, reticulocyte, and erythrocyte cell numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,849,714 V323A unknown Het
AC117241.1 A G 17: 7,352,688 V158A unknown Het
Acadm A G 3: 153,941,881 probably null Het
Adcy10 T G 1: 165,543,470 probably null Het
Aldh6a1 C T 12: 84,441,831 A94T probably benign Het
Ano2 T A 6: 125,790,293 L229Q probably damaging Het
Cacna1h C T 17: 25,377,655 R1828H probably damaging Het
Ccdc33 A T 9: 58,034,173 probably null Het
Cep112 A C 11: 108,682,844 D6A probably benign Het
Chd9 T C 8: 91,006,622 F1373S unknown Het
Cog5 T C 12: 31,685,708 L158P probably damaging Het
Col6a3 G A 1: 90,803,678 Q1618* probably null Het
Dlg5 A G 14: 24,244,856 V3A Het
Dnah7a T A 1: 53,620,461 probably null Het
Dpp10 A T 1: 123,341,151 H716Q probably benign Het
Epor A G 9: 21,963,329 F35L probably benign Het
Ergic1 A T 17: 26,654,882 Y92F Het
Fam71a C T 1: 191,163,351 R365H probably damaging Het
Fam98a G A 17: 75,539,018 Q273* probably null Het
Fhdc1 G A 3: 84,448,850 T429I probably damaging Het
Fmnl2 T A 2: 53,107,441 L468Q unknown Het
Fmnl3 C T 15: 99,321,782 R695Q probably damaging Het
Gabrg2 T C 11: 41,920,506 M271V probably damaging Het
Gk5 G T 9: 96,119,526 V26L possibly damaging Het
Gm14412 A C 2: 177,315,615 N162K probably benign Het
Gm3604 T C 13: 62,371,875 D22G probably damaging Het
Gm5565 G T 5: 146,158,055 H294N probably benign Het
Hsf2 T A 10: 57,505,176 D287E possibly damaging Het
Impdh2 G A 9: 108,563,208 R231H possibly damaging Het
Irak3 T C 10: 120,166,511 H234R probably damaging Het
Lrba GTTCCCTTC GTTC 3: 86,741,458 probably null Het
Lrch3 T A 16: 32,993,779 D551E probably benign Het
Manba A T 3: 135,567,513 N736I probably benign Het
Map2 A G 1: 66,412,653 D234G possibly damaging Het
Mdk C A 2: 91,930,852 K121N unknown Het
Mfn1 T A 3: 32,564,220 L526Q probably damaging Het
Mnat1 G T 12: 73,230,678 E233* probably null Het
Mtmr4 T C 11: 87,604,605 probably null Het
Mtrf1 A G 14: 79,423,464 E432G possibly damaging Het
Muc5b C T 7: 141,842,645 R165C unknown Het
Naip6 T A 13: 100,316,149 I135F probably benign Het
Nod2 A G 8: 88,663,832 T256A probably benign Het
Notch4 T A 17: 34,583,499 V1298E probably damaging Het
Nudc G T 4: 133,534,465 D169E possibly damaging Het
Obscn A T 11: 59,035,101 I5602N probably damaging Het
Olfr1468-ps1 G A 19: 13,375,844 G294E unknown Het
Osbpl10 G A 9: 115,067,251 D18N probably damaging Het
Pigk G A 3: 152,722,551 V72I possibly damaging Het
Prl8a6 C T 13: 27,437,170 E26K probably damaging Het
Prpf8 A G 11: 75,490,727 Y318C possibly damaging Het
Rab13 A G 3: 90,224,763 D159G possibly damaging Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Ryr2 T C 13: 11,759,757 H1171R probably benign Het
Scn4a T A 11: 106,330,308 I842F probably benign Het
Scnm1 A T 3: 95,133,854 N14K possibly damaging Het
Serinc1 A T 10: 57,524,361 I137N probably benign Het
Slc30a3 T C 5: 31,086,825 Q371R probably benign Het
Slc30a3 A C 5: 31,089,670 M103R probably damaging Het
Slco1a1 A T 6: 141,911,839 C589S probably damaging Het
Slco1b2 A G 6: 141,656,930 Y203C probably damaging Het
Spty2d1 A T 7: 46,998,523 D219E probably benign Het
Svep1 A T 4: 58,043,991 S3552T probably benign Het
Tmem62 A G 2: 121,004,743 I516M probably benign Het
Trim61 A T 8: 65,013,614 S332T probably damaging Het
Trmt10b A C 4: 45,308,520 T227P probably benign Het
Trpc3 T C 3: 36,655,109 Q406R probably benign Het
Ttc30b A T 2: 75,937,949 Y153* probably null Het
Ush2a A T 1: 188,753,543 Y2950F probably benign Het
Usp32 C T 11: 85,040,170 G478D probably benign Het
Wdfy3 A G 5: 101,943,892 L527P possibly damaging Het
Wdr73 A G 7: 80,893,678 V163A possibly damaging Het
Other mutations in Mfsd2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01810:Mfsd2b APN 12 4866469 missense possibly damaging 0.63
IGL03188:Mfsd2b APN 12 4866538 splice site probably null
IGL03339:Mfsd2b APN 12 4874335 start codon destroyed probably null
R0142:Mfsd2b UTSW 12 4866234 missense probably benign 0.11
R1468:Mfsd2b UTSW 12 4870536 nonsense probably null
R1468:Mfsd2b UTSW 12 4870536 nonsense probably null
R1535:Mfsd2b UTSW 12 4870605 missense probably damaging 1.00
R1718:Mfsd2b UTSW 12 4869037 missense probably damaging 1.00
R1894:Mfsd2b UTSW 12 4869155 missense probably damaging 0.99
R2127:Mfsd2b UTSW 12 4867659 missense probably benign 0.01
R2392:Mfsd2b UTSW 12 4865164 missense possibly damaging 0.73
R3737:Mfsd2b UTSW 12 4870578 missense probably damaging 1.00
R3738:Mfsd2b UTSW 12 4870578 missense probably damaging 1.00
R3739:Mfsd2b UTSW 12 4870578 missense probably damaging 1.00
R3956:Mfsd2b UTSW 12 4866848 missense probably damaging 1.00
R4035:Mfsd2b UTSW 12 4870578 missense probably damaging 1.00
R4244:Mfsd2b UTSW 12 4874356 utr 5 prime probably benign
R4595:Mfsd2b UTSW 12 4865807 missense possibly damaging 0.87
R4667:Mfsd2b UTSW 12 4867636 missense probably benign 0.01
R4723:Mfsd2b UTSW 12 4868992 missense probably benign 0.03
R5126:Mfsd2b UTSW 12 4866183 missense probably benign 0.30
R5145:Mfsd2b UTSW 12 4865908 unclassified probably benign
R5890:Mfsd2b UTSW 12 4867651 missense probably damaging 1.00
R5976:Mfsd2b UTSW 12 4866522 missense probably damaging 1.00
R6753:Mfsd2b UTSW 12 4867358 missense possibly damaging 0.90
R6912:Mfsd2b UTSW 12 4870611 nonsense probably null
X0062:Mfsd2b UTSW 12 4865170 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AACCAGCCAGCAGTATGTC -3'
(R):5'- AACAGGGCTCCCTTGTATCTG -3'

Sequencing Primer
(F):5'- CAGCCAGCAGTATGTCTGTGTTC -3'
(R):5'- TACAGGGCTGAGCTTCCTAAG -3'
Posted On2019-06-26