Incidental Mutation 'R7182:Dlg5'
ID559073
Institutional Source Beutler Lab
Gene Symbol Dlg5
Ensembl Gene ENSMUSG00000021782
Gene Namediscs large MAGUK scaffold protein 5
Synonyms4933429D20Rik
MMRRC Submission
Accession Numbers

Genbank: NM_001163513; MGI: 1918478

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7182 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location24133953-24245920 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24244856 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 3 (V3A)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073687] [ENSMUST00000090398]
Predicted Effect probably benign
Transcript: ENSMUST00000073687
SMART Domains Protein: ENSMUSP00000073367
Gene: ENSMUSG00000021782

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
low complexity region 22 36 N/A INTRINSIC
low complexity region 44 66 N/A INTRINSIC
Pfam:Takusan 104 191 1.4e-27 PFAM
coiled coil region 308 578 N/A INTRINSIC
low complexity region 592 605 N/A INTRINSIC
PDZ 610 687 2.02e-10 SMART
PDZ 695 773 1.25e-15 SMART
low complexity region 836 843 N/A INTRINSIC
low complexity region 1018 1037 N/A INTRINSIC
low complexity region 1229 1244 N/A INTRINSIC
PDZ 1335 1406 2.1e-17 SMART
PDZ 1490 1562 2.97e-8 SMART
SH3 1576 1640 3.73e-7 SMART
low complexity region 1664 1684 N/A INTRINSIC
GuKc 1701 1887 5.43e-53 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000090398
SMART Domains Protein: ENSMUSP00000087879
Gene: ENSMUSG00000021782

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
low complexity region 22 36 N/A INTRINSIC
low complexity region 44 66 N/A INTRINSIC
low complexity region 109 123 N/A INTRINSIC
Pfam:Takusan 128 213 6e-33 PFAM
coiled coil region 331 601 N/A INTRINSIC
low complexity region 615 628 N/A INTRINSIC
PDZ 633 710 2.02e-10 SMART
PDZ 718 796 1.25e-15 SMART
low complexity region 859 866 N/A INTRINSIC
low complexity region 1041 1060 N/A INTRINSIC
low complexity region 1252 1267 N/A INTRINSIC
PDZ 1358 1429 2.1e-17 SMART
PDZ 1513 1585 2.97e-8 SMART
SH3 1599 1663 3.73e-7 SMART
low complexity region 1687 1707 N/A INTRINSIC
GuKc 1724 1910 5.43e-53 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000131986
Gene: ENSMUSG00000021782
AA Change: V3A

DomainStartEndE-ValueType
low complexity region 26 40 N/A INTRINSIC
Pfam:Takusan 45 130 1.9e-34 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 96% (70/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the family of discs large (DLG) homologs, a subset of the membrane-associated guanylate kinase (MAGUK) superfamily. The MAGUK proteins are composed of a catalytically inactive guanylate kinase domain, in addition to PDZ and SH3 domains, and are thought to function as scaffolding molecules at sites of cell-cell contact. The protein encoded by this gene localizes to the plasma membrane and cytoplasm, and interacts with components of adherens junctions and the cytoskeleton. It is proposed to function in the transmission of extracellular signals to the cytoskeleton and in the maintenance of epithelial cell structure. Alternative splice variants have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit growth retardation, hydroencephaly, abnormal brain morphology, abnormal neurogenesis, kidney cysts, ureter defects, and abnormal kidney morphology. [provided by MGI curators]
Allele List at MGI

All alleles(19) : Targeted, other(1) Gene trapped(18)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,849,714 V323A unknown Het
AC117241.1 A G 17: 7,352,688 V158A unknown Het
Acadm A G 3: 153,941,881 probably null Het
Adcy10 T G 1: 165,543,470 probably null Het
Aldh6a1 C T 12: 84,441,831 A94T probably benign Het
Ano2 T A 6: 125,790,293 L229Q probably damaging Het
Cacna1h C T 17: 25,377,655 R1828H probably damaging Het
Ccdc33 A T 9: 58,034,173 probably null Het
Cep112 A C 11: 108,682,844 D6A probably benign Het
Chd9 T C 8: 91,006,622 F1373S unknown Het
Cog5 T C 12: 31,685,708 L158P probably damaging Het
Col6a3 G A 1: 90,803,678 Q1618* probably null Het
Dnah7a T A 1: 53,620,461 probably null Het
Dpp10 A T 1: 123,341,151 H716Q probably benign Het
Epor A G 9: 21,963,329 F35L probably benign Het
Ergic1 A T 17: 26,654,882 Y92F Het
Fam71a C T 1: 191,163,351 R365H probably damaging Het
Fam98a G A 17: 75,539,018 Q273* probably null Het
Fhdc1 G A 3: 84,448,850 T429I probably damaging Het
Fmnl2 T A 2: 53,107,441 L468Q unknown Het
Fmnl3 C T 15: 99,321,782 R695Q probably damaging Het
Gabrg2 T C 11: 41,920,506 M271V probably damaging Het
Gk5 G T 9: 96,119,526 V26L possibly damaging Het
Gm14412 A C 2: 177,315,615 N162K probably benign Het
Gm3604 T C 13: 62,371,875 D22G probably damaging Het
Gm5565 G T 5: 146,158,055 H294N probably benign Het
Hsf2 T A 10: 57,505,176 D287E possibly damaging Het
Impdh2 G A 9: 108,563,208 R231H possibly damaging Het
Irak3 T C 10: 120,166,511 H234R probably damaging Het
Lrba GTTCCCTTC GTTC 3: 86,741,458 probably null Het
Lrch3 T A 16: 32,993,779 D551E probably benign Het
Manba A T 3: 135,567,513 N736I probably benign Het
Map2 A G 1: 66,412,653 D234G possibly damaging Het
Mdk C A 2: 91,930,852 K121N unknown Het
Mfn1 T A 3: 32,564,220 L526Q probably damaging Het
Mfsd2b A G 12: 4,866,157 probably null Het
Mnat1 G T 12: 73,230,678 E233* probably null Het
Mtmr4 T C 11: 87,604,605 probably null Het
Mtrf1 A G 14: 79,423,464 E432G possibly damaging Het
Muc5b C T 7: 141,842,645 R165C unknown Het
Naip6 T A 13: 100,316,149 I135F probably benign Het
Nod2 A G 8: 88,663,832 T256A probably benign Het
Notch4 T A 17: 34,583,499 V1298E probably damaging Het
Nudc G T 4: 133,534,465 D169E possibly damaging Het
Obscn A T 11: 59,035,101 I5602N probably damaging Het
Olfr1468-ps1 G A 19: 13,375,844 G294E unknown Het
Osbpl10 G A 9: 115,067,251 D18N probably damaging Het
Pigk G A 3: 152,722,551 V72I possibly damaging Het
Prl8a6 C T 13: 27,437,170 E26K probably damaging Het
Prpf8 A G 11: 75,490,727 Y318C possibly damaging Het
Rab13 A G 3: 90,224,763 D159G possibly damaging Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Ryr2 T C 13: 11,759,757 H1171R probably benign Het
Scn4a T A 11: 106,330,308 I842F probably benign Het
Scnm1 A T 3: 95,133,854 N14K possibly damaging Het
Serinc1 A T 10: 57,524,361 I137N probably benign Het
Slc30a3 T C 5: 31,086,825 Q371R probably benign Het
Slc30a3 A C 5: 31,089,670 M103R probably damaging Het
Slco1a1 A T 6: 141,911,839 C589S probably damaging Het
Slco1b2 A G 6: 141,656,930 Y203C probably damaging Het
Spty2d1 A T 7: 46,998,523 D219E probably benign Het
Svep1 A T 4: 58,043,991 S3552T probably benign Het
Tmem62 A G 2: 121,004,743 I516M probably benign Het
Trim61 A T 8: 65,013,614 S332T probably damaging Het
Trmt10b A C 4: 45,308,520 T227P probably benign Het
Trpc3 T C 3: 36,655,109 Q406R probably benign Het
Ttc30b A T 2: 75,937,949 Y153* probably null Het
Ush2a A T 1: 188,753,543 Y2950F probably benign Het
Usp32 C T 11: 85,040,170 G478D probably benign Het
Wdfy3 A G 5: 101,943,892 L527P possibly damaging Het
Wdr73 A G 7: 80,893,678 V163A possibly damaging Het
Other mutations in Dlg5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Dlg5 APN 14 24191161 missense probably damaging 0.99
IGL00164:Dlg5 APN 14 24158464 missense possibly damaging 0.89
IGL00767:Dlg5 APN 14 24165285 missense probably damaging 1.00
IGL01284:Dlg5 APN 14 24146197 missense probably damaging 1.00
IGL01328:Dlg5 APN 14 24202351 missense probably damaging 0.98
IGL01532:Dlg5 APN 14 24158592 missense probably benign
IGL01621:Dlg5 APN 14 24148221 missense probably damaging 1.00
IGL01649:Dlg5 APN 14 24138691 missense probably damaging 1.00
IGL01733:Dlg5 APN 14 24170449 missense probably damaging 1.00
IGL02048:Dlg5 APN 14 24172203 missense possibly damaging 0.87
IGL02103:Dlg5 APN 14 24144346 missense probably damaging 1.00
IGL02138:Dlg5 APN 14 24158351 missense probably benign
IGL02146:Dlg5 APN 14 24202361 missense probably damaging 0.99
IGL02392:Dlg5 APN 14 24150209 missense probably damaging 1.00
IGL02427:Dlg5 APN 14 24166207 missense probably damaging 1.00
IGL02643:Dlg5 APN 14 24191182 missense probably damaging 1.00
IGL02649:Dlg5 APN 14 24146251 missense probably damaging 0.96
IGL02933:Dlg5 APN 14 24158499 missense probably benign 0.06
IGL02965:Dlg5 APN 14 24172023 missense probably damaging 1.00
IGL02988:Dlg5 APN 14 24166255 missense probably damaging 1.00
IGL03351:Dlg5 APN 14 24170454 missense probably benign 0.03
R0123:Dlg5 UTSW 14 24147206 missense probably benign
R0131:Dlg5 UTSW 14 24138649 missense probably damaging 1.00
R0709:Dlg5 UTSW 14 24146255 missense probably damaging 1.00
R0920:Dlg5 UTSW 14 24176397 missense probably damaging 1.00
R0924:Dlg5 UTSW 14 24135577 missense probably damaging 1.00
R0930:Dlg5 UTSW 14 24135577 missense probably damaging 1.00
R0981:Dlg5 UTSW 14 24154631 missense probably damaging 1.00
R1402:Dlg5 UTSW 14 24176608 missense probably benign 0.06
R1402:Dlg5 UTSW 14 24176608 missense probably benign 0.06
R1438:Dlg5 UTSW 14 24154605 missense possibly damaging 0.94
R1449:Dlg5 UTSW 14 24135643 missense possibly damaging 0.82
R1465:Dlg5 UTSW 14 24154696 splice site probably null
R1465:Dlg5 UTSW 14 24154696 splice site probably null
R1543:Dlg5 UTSW 14 24144448 missense probably damaging 1.00
R1824:Dlg5 UTSW 14 24149444 missense probably benign 0.28
R1899:Dlg5 UTSW 14 24148300 missense probably damaging 1.00
R1920:Dlg5 UTSW 14 24176571 missense probably damaging 1.00
R1921:Dlg5 UTSW 14 24176571 missense probably damaging 1.00
R1951:Dlg5 UTSW 14 24156469 splice site probably benign
R1968:Dlg5 UTSW 14 24164119 nonsense probably null
R2049:Dlg5 UTSW 14 24154647 missense probably damaging 1.00
R2070:Dlg5 UTSW 14 24136635 missense probably damaging 1.00
R2117:Dlg5 UTSW 14 24177758 nonsense probably null
R2139:Dlg5 UTSW 14 24170544 missense probably damaging 1.00
R2153:Dlg5 UTSW 14 24137157 missense probably damaging 1.00
R2283:Dlg5 UTSW 14 24158663 missense probably benign 0.00
R2293:Dlg5 UTSW 14 24158112 missense probably benign
R2356:Dlg5 UTSW 14 24170428 critical splice donor site probably null
R2362:Dlg5 UTSW 14 24158687 missense probably benign 0.04
R2513:Dlg5 UTSW 14 24164525 missense probably damaging 1.00
R3084:Dlg5 UTSW 14 24166190 missense probably damaging 1.00
R3086:Dlg5 UTSW 14 24166190 missense probably damaging 1.00
R3750:Dlg5 UTSW 14 24165260 missense probably damaging 1.00
R3780:Dlg5 UTSW 14 24190310 unclassified probably benign
R3782:Dlg5 UTSW 14 24190310 unclassified probably benign
R3828:Dlg5 UTSW 14 24146158 missense probably damaging 0.99
R4079:Dlg5 UTSW 14 24148260 missense possibly damaging 0.94
R4393:Dlg5 UTSW 14 24177989 critical splice acceptor site probably null
R4615:Dlg5 UTSW 14 24158168 missense probably damaging 1.00
R4664:Dlg5 UTSW 14 24137181 missense possibly damaging 0.90
R4712:Dlg5 UTSW 14 24177983 missense possibly damaging 0.94
R4796:Dlg5 UTSW 14 24144383 missense probably damaging 1.00
R4801:Dlg5 UTSW 14 24154689 missense probably damaging 1.00
R4802:Dlg5 UTSW 14 24154689 missense probably damaging 1.00
R4946:Dlg5 UTSW 14 24154361 missense probably damaging 0.99
R5022:Dlg5 UTSW 14 24136622 missense probably damaging 1.00
R5023:Dlg5 UTSW 14 24136622 missense probably damaging 1.00
R5057:Dlg5 UTSW 14 24136622 missense probably damaging 1.00
R5234:Dlg5 UTSW 14 24192862 missense probably damaging 0.98
R5561:Dlg5 UTSW 14 24177792 missense probably benign 0.03
R5567:Dlg5 UTSW 14 24192913 nonsense probably null
R5570:Dlg5 UTSW 14 24192913 nonsense probably null
R5640:Dlg5 UTSW 14 24170461 missense probably damaging 1.00
R5646:Dlg5 UTSW 14 24158699 missense probably damaging 1.00
R5711:Dlg5 UTSW 14 24150648 missense probably damaging 1.00
R5810:Dlg5 UTSW 14 24146254 missense probably damaging 0.99
R5900:Dlg5 UTSW 14 24149447 missense probably damaging 1.00
R5964:Dlg5 UTSW 14 24164089 missense probably benign
R6190:Dlg5 UTSW 14 24190438 missense probably damaging 0.99
R6240:Dlg5 UTSW 14 24149528 intron probably null
R6276:Dlg5 UTSW 14 24164568 missense probably damaging 1.00
R6339:Dlg5 UTSW 14 24158060 missense probably damaging 1.00
R6508:Dlg5 UTSW 14 24138706 missense probably benign 0.45
R6527:Dlg5 UTSW 14 24190448 missense possibly damaging 0.73
R6593:Dlg5 UTSW 14 24150652 missense probably benign 0.01
R6687:Dlg5 UTSW 14 24190373 missense probably damaging 1.00
R6965:Dlg5 UTSW 14 24149430 missense probably damaging 1.00
R7051:Dlg5 UTSW 14 24146195 missense possibly damaging 0.93
R7075:Dlg5 UTSW 14 24177797 missense possibly damaging 0.49
R7149:Dlg5 UTSW 14 24190424 missense probably benign 0.00
R7203:Dlg5 UTSW 14 24138655 missense probably damaging 1.00
R7216:Dlg5 UTSW 14 24136638 nonsense probably null
R7359:Dlg5 UTSW 14 24164547 missense probably damaging 1.00
YA93:Dlg5 UTSW 14 24155133 unclassified probably benign
Z1088:Dlg5 UTSW 14 24158094 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCACAGCAAATCTGGGCG -3'
(R):5'- TCTCTCTGCAGCTCACCAAG -3'

Sequencing Primer
(F):5'- CAGCAAATCTGGGCGAGTTAG -3'
(R):5'- ACCGCTCTACCTGTATGGCG -3'
Posted On2019-06-26