Incidental Mutation 'R7184:Gm4788'
ID559150
Institutional Source Beutler Lab
Gene Symbol Gm4788
Ensembl Gene ENSMUSG00000070594
Gene Namepredicted gene 4788
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R7184 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location139697623-139781243 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 139733084 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 622 (V622A)
Ref Sequence ENSEMBL: ENSMUSP00000107620 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027612] [ENSMUST00000111986] [ENSMUST00000111989]
Predicted Effect probably benign
Transcript: ENSMUST00000027612
SMART Domains Protein: ENSMUSP00000027612
Gene: ENSMUSG00000070594

DomainStartEndE-ValueType
CCP 28 88 1.65e-2 SMART
CCP 92 145 1.15e-10 SMART
CCP 151 208 5.65e-10 SMART
CCP 212 267 1.12e-4 SMART
CCP 272 325 4.52e-9 SMART
CCP 332 386 9.1e-14 SMART
CCP 393 446 1.58e-13 SMART
CCP 455 505 4.92e-1 SMART
CCP 511 564 8.9e-8 SMART
CCP 569 622 4.18e-13 SMART
CCP 627 681 3.5e-15 SMART
CCP 688 742 5.69e-15 SMART
CCP 746 807 2.77e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111986
AA Change: V622A

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000107617
Gene: ENSMUSG00000070594
AA Change: V622A

DomainStartEndE-ValueType
CCP 28 88 1.65e-2 SMART
CCP 92 145 1.15e-10 SMART
CCP 151 208 5.65e-10 SMART
CCP 212 267 1.12e-4 SMART
CCP 272 325 4.52e-9 SMART
CCP 333 387 9.1e-14 SMART
CCP 394 447 1.58e-13 SMART
CCP 456 506 4.92e-1 SMART
CCP 512 565 8.9e-8 SMART
CCP 571 635 2.66e-6 SMART
CCP 640 693 4.18e-13 SMART
CCP 700 754 5.69e-15 SMART
CCP 758 819 2.77e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111989
AA Change: V622A

PolyPhen 2 Score 0.647 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000107620
Gene: ENSMUSG00000070594
AA Change: V622A

DomainStartEndE-ValueType
CCP 28 88 1.65e-2 SMART
CCP 92 145 1.15e-10 SMART
CCP 151 208 5.65e-10 SMART
CCP 212 267 1.12e-4 SMART
CCP 272 325 4.52e-9 SMART
CCP 333 387 9.1e-14 SMART
CCP 394 447 1.58e-13 SMART
CCP 456 506 4.92e-1 SMART
CCP 512 565 8.9e-8 SMART
CCP 571 635 2.66e-6 SMART
CCP 640 693 4.18e-13 SMART
CCP 698 752 3.5e-15 SMART
CCP 759 813 5.69e-15 SMART
CCP 817 878 2.77e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (63/63)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik T C 1: 93,154,515 N294S probably benign Het
Aass A G 6: 23,094,220 S500P possibly damaging Het
Aldh9a1 T A 1: 167,357,396 N292K probably benign Het
Art2b A T 7: 101,580,451 S80R probably benign Het
Atp6v1b2 G T 8: 69,102,567 A194S possibly damaging Het
Bsnd T C 4: 106,491,912 M44V probably damaging Het
Cadps2 A T 6: 23,583,429 V383E probably benign Het
Cd93 T C 2: 148,442,539 T296A possibly damaging Het
Cdk15 G T 1: 59,265,655 E138D probably benign Het
Cdon A G 9: 35,463,895 I406V probably benign Het
Cyp3a41a A G 5: 145,705,853 V232A probably benign Het
Dbndd1 T A 8: 123,509,121 D130V probably damaging Het
Dnah14 C T 1: 181,704,529 R2294* probably null Het
Eddm3b A G 14: 51,116,930 Y125C probably damaging Het
Enah A T 1: 181,922,392 V294E probably damaging Het
Farp2 A G 1: 93,603,415 E545G probably damaging Het
Farsb T C 1: 78,482,357 E22G possibly damaging Het
Fezf1 A G 6: 23,247,836 V80A probably benign Het
Fpr2 T C 17: 17,893,271 Y39H unknown Het
Fsd1l C A 4: 53,694,054 R344S probably damaging Het
Fuk G A 8: 110,887,156 P758S probably damaging Het
Fxyd1 G T 7: 31,051,976 R90S unknown Het
Galnt4 T A 10: 99,108,604 Y64N probably damaging Het
Gatb C T 3: 85,636,951 Q409* probably null Het
Glipr2 A C 4: 43,968,667 D73A possibly damaging Het
Gm2035 G A 12: 87,919,722 R46W possibly damaging Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gpr88 C T 3: 116,251,994 V223I possibly damaging Het
Gtf2h3 A G 5: 124,584,004 N55S probably benign Het
Htr4 T A 18: 62,437,427 C184* probably null Het
Ighv6-3 T A 12: 114,391,855 R71S probably benign Het
Itpr2 G C 6: 146,311,087 I1510M possibly damaging Het
Keap1 T C 9: 21,233,838 Q292R probably benign Het
Malt1 A C 18: 65,447,693 E219D probably benign Het
Manba T C 3: 135,523,154 V279A possibly damaging Het
Map4k5 T A 12: 69,874,321 H41L probably benign Het
Mcm2 T G 6: 88,891,794 Y327S probably damaging Het
Nectin3 A G 16: 46,395,121 I503T possibly damaging Het
Nqo1 T C 8: 107,392,647 I99M probably damaging Het
Nrxn2 A G 19: 6,490,552 H845R probably damaging Het
Otogl C T 10: 107,763,200 C2254Y probably damaging Het
Pmm1 T C 15: 81,956,214 N110S probably damaging Het
Poc1b G T 10: 99,134,337 C68F probably benign Het
Polr1b A G 2: 129,123,922 Y828C possibly damaging Het
Prl3d1 A G 13: 27,098,636 H119R probably damaging Het
Pum3 A G 19: 27,426,012 S30P probably benign Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Rusc1 T C 3: 89,091,887 E196G possibly damaging Het
Sf3a3 A G 4: 124,714,979 K29E probably benign Het
Slc13a1 A T 6: 24,092,312 I475K probably damaging Het
Slc26a5 G T 5: 21,837,246 Y237* probably null Het
Slc7a14 C T 3: 31,227,063 G366D probably damaging Het
Tbc1d5 A G 17: 50,800,082 V482A probably benign Het
Tdrd5 G T 1: 156,259,935 Q883K probably benign Het
Tet2 T C 3: 133,473,630 Y1258C probably damaging Het
Upf2 A G 2: 6,023,320 D739G unknown Het
Vmn1r122 A T 7: 21,133,895 F78L probably benign Het
Vmn1r75 A T 7: 11,880,988 K216* probably null Het
Vmn2r11 A T 5: 109,053,415 Y408N probably damaging Het
Wscd1 T A 11: 71,788,717 V472D probably damaging Het
Zdbf2 G T 1: 63,306,505 V1348F possibly damaging Het
Zfp442 G T 2: 150,408,136 H615Q possibly damaging Het
Zfp457 C A 13: 67,294,001 C170F possibly damaging Het
Zscan10 A G 17: 23,607,029 probably null Het
Other mutations in Gm4788
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00906:Gm4788 APN 1 139731574 missense probably damaging 0.99
IGL01088:Gm4788 APN 1 139698085 utr 3 prime probably benign
IGL01419:Gm4788 APN 1 139739644 critical splice acceptor site probably null
IGL01552:Gm4788 APN 1 139739302 missense probably damaging 1.00
IGL01924:Gm4788 APN 1 139739206 missense probably damaging 0.99
IGL02032:Gm4788 APN 1 139774546 missense probably damaging 1.00
IGL02254:Gm4788 APN 1 139733405 splice site probably benign
IGL02318:Gm4788 APN 1 139781097 missense probably benign 0.20
IGL02527:Gm4788 APN 1 139753045 missense probably damaging 1.00
IGL02531:Gm4788 APN 1 139774569 missense probably benign 0.10
IGL02587:Gm4788 APN 1 139701930 missense probably damaging 1.00
IGL02644:Gm4788 APN 1 139781167 start codon destroyed probably null 0.63
IGL02852:Gm4788 APN 1 139774016 missense probably damaging 1.00
IGL02963:Gm4788 APN 1 139731596 nonsense probably null
IGL03084:Gm4788 APN 1 139781142 missense possibly damaging 0.94
R0131:Gm4788 UTSW 1 139754271 missense probably damaging 0.98
R0131:Gm4788 UTSW 1 139754271 missense probably damaging 0.98
R0132:Gm4788 UTSW 1 139754271 missense probably damaging 0.98
R0549:Gm4788 UTSW 1 139739488 missense probably damaging 1.00
R0558:Gm4788 UTSW 1 139739492 missense probably damaging 0.99
R0610:Gm4788 UTSW 1 139701846 missense probably benign 0.20
R1341:Gm4788 UTSW 1 139732393 missense probably damaging 0.98
R1460:Gm4788 UTSW 1 139698196 missense probably damaging 0.99
R1544:Gm4788 UTSW 1 139736870 missense probably damaging 1.00
R1873:Gm4788 UTSW 1 139774660 missense probably damaging 0.97
R2032:Gm4788 UTSW 1 139733255 splice site probably benign
R2111:Gm4788 UTSW 1 139774679 splice site probably benign
R2179:Gm4788 UTSW 1 139731541 missense probably damaging 1.00
R3806:Gm4788 UTSW 1 139753035 missense probably damaging 1.00
R4356:Gm4788 UTSW 1 139732310 missense probably damaging 1.00
R4747:Gm4788 UTSW 1 139698184 missense probably damaging 1.00
R4838:Gm4788 UTSW 1 139733443 missense probably damaging 1.00
R4867:Gm4788 UTSW 1 139774475 critical splice donor site probably null
R4910:Gm4788 UTSW 1 139774563 missense probably damaging 1.00
R4911:Gm4788 UTSW 1 139774563 missense probably damaging 1.00
R5050:Gm4788 UTSW 1 139736840 missense probably damaging 0.99
R5120:Gm4788 UTSW 1 139753103 missense probably benign 0.39
R5259:Gm4788 UTSW 1 139740495 missense probably damaging 1.00
R5504:Gm4788 UTSW 1 139701820 missense probably benign 0.18
R5825:Gm4788 UTSW 1 139774598 synonymous probably null
R5949:Gm4788 UTSW 1 139733149 missense probably damaging 0.98
R6140:Gm4788 UTSW 1 139732395 missense probably damaging 1.00
R6200:Gm4788 UTSW 1 139754335 missense probably damaging 0.97
R6254:Gm4788 UTSW 1 139754390 missense probably damaging 0.98
R6255:Gm4788 UTSW 1 139753011 nonsense probably null
R6334:Gm4788 UTSW 1 139773924 unclassified probably null
R6611:Gm4788 UTSW 1 139732390 missense probably damaging 1.00
R6798:Gm4788 UTSW 1 139698121 missense probably benign 0.20
R6800:Gm4788 UTSW 1 139701981 missense possibly damaging 0.85
R6895:Gm4788 UTSW 1 139740472 missense possibly damaging 0.84
R6904:Gm4788 UTSW 1 139731653 missense possibly damaging 0.79
R6994:Gm4788 UTSW 1 139736930 missense possibly damaging 0.67
R7173:Gm4788 UTSW 1 139731677 nonsense probably null
R7192:Gm4788 UTSW 1 139739295 missense probably damaging 0.96
R7205:Gm4788 UTSW 1 139753050 nonsense probably null
R7308:Gm4788 UTSW 1 139754303 missense possibly damaging 0.71
X0009:Gm4788 UTSW 1 139733549 missense probably benign 0.08
X0024:Gm4788 UTSW 1 139733509 missense probably damaging 1.00
Z1088:Gm4788 UTSW 1 139754261 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACAAGAGTGGGTGAATTCTATAGAC -3'
(R):5'- TCACTGCATTGGTCAGTAGC -3'

Sequencing Primer
(F):5'- GCAGCATAGATTGAATTATGCAAG -3'
(R):5'- CACTGCATTGGTCAGTAGCTATGAC -3'
Posted On2019-06-26