Incidental Mutation 'R7184:Atp6v1b2'
ID559184
Institutional Source Beutler Lab
Gene Symbol Atp6v1b2
Ensembl Gene ENSMUSG00000006273
Gene NameATPase, H+ transporting, lysosomal V1 subunit B2
SynonymsAtp6b2, HO57
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7184 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location69088646-69113711 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 69102567 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 194 (A194S)
Ref Sequence ENSEMBL: ENSMUSP00000006435 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006435]
Predicted Effect possibly damaging
Transcript: ENSMUST00000006435
AA Change: A194S

PolyPhen 2 Score 0.554 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000006435
Gene: ENSMUSG00000006273
AA Change: A194S

DomainStartEndE-ValueType
Pfam:ATP-synt_ab_N 50 116 3.2e-14 PFAM
Pfam:ATP-synt_ab 173 399 1.9e-69 PFAM
Pfam:ATP-synt_ab_C 416 510 5.1e-18 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A, three B, and two G subunits, as well as a C, D, E, F, and H subunit. The V1 domain contains the ATP catalytic site. The protein encoded by this gene is one of two V1 domain B subunit isoforms and is the only B isoform highly expressed in osteoclasts. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik T C 1: 93,154,515 N294S probably benign Het
Aass A G 6: 23,094,220 S500P possibly damaging Het
Aldh9a1 T A 1: 167,357,396 N292K probably benign Het
Art2b A T 7: 101,580,451 S80R probably benign Het
Bsnd T C 4: 106,491,912 M44V probably damaging Het
Cadps2 A T 6: 23,583,429 V383E probably benign Het
Cd93 T C 2: 148,442,539 T296A possibly damaging Het
Cdk15 G T 1: 59,265,655 E138D probably benign Het
Cdon A G 9: 35,463,895 I406V probably benign Het
Cyp3a41a A G 5: 145,705,853 V232A probably benign Het
Dbndd1 T A 8: 123,509,121 D130V probably damaging Het
Dnah14 C T 1: 181,704,529 R2294* probably null Het
Eddm3b A G 14: 51,116,930 Y125C probably damaging Het
Enah A T 1: 181,922,392 V294E probably damaging Het
Farp2 A G 1: 93,603,415 E545G probably damaging Het
Farsb T C 1: 78,482,357 E22G possibly damaging Het
Fezf1 A G 6: 23,247,836 V80A probably benign Het
Fpr2 T C 17: 17,893,271 Y39H unknown Het
Fsd1l C A 4: 53,694,054 R344S probably damaging Het
Fuk G A 8: 110,887,156 P758S probably damaging Het
Fxyd1 G T 7: 31,051,976 R90S unknown Het
Galnt4 T A 10: 99,108,604 Y64N probably damaging Het
Gatb C T 3: 85,636,951 Q409* probably null Het
Glipr2 A C 4: 43,968,667 D73A possibly damaging Het
Gm2035 G A 12: 87,919,722 R46W possibly damaging Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gm4788 A G 1: 139,733,084 V622A possibly damaging Het
Gpr88 C T 3: 116,251,994 V223I possibly damaging Het
Gtf2h3 A G 5: 124,584,004 N55S probably benign Het
Htr4 T A 18: 62,437,427 C184* probably null Het
Ighv6-3 T A 12: 114,391,855 R71S probably benign Het
Itpr2 G C 6: 146,311,087 I1510M possibly damaging Het
Keap1 T C 9: 21,233,838 Q292R probably benign Het
Malt1 A C 18: 65,447,693 E219D probably benign Het
Manba T C 3: 135,523,154 V279A possibly damaging Het
Map4k5 T A 12: 69,874,321 H41L probably benign Het
Mcm2 T G 6: 88,891,794 Y327S probably damaging Het
Nectin3 A G 16: 46,395,121 I503T possibly damaging Het
Nqo1 T C 8: 107,392,647 I99M probably damaging Het
Nrxn2 A G 19: 6,490,552 H845R probably damaging Het
Otogl C T 10: 107,763,200 C2254Y probably damaging Het
Pmm1 T C 15: 81,956,214 N110S probably damaging Het
Poc1b G T 10: 99,134,337 C68F probably benign Het
Polr1b A G 2: 129,123,922 Y828C possibly damaging Het
Prl3d1 A G 13: 27,098,636 H119R probably damaging Het
Pum3 A G 19: 27,426,012 S30P probably benign Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Rusc1 T C 3: 89,091,887 E196G possibly damaging Het
Sf3a3 A G 4: 124,714,979 K29E probably benign Het
Slc13a1 A T 6: 24,092,312 I475K probably damaging Het
Slc26a5 G T 5: 21,837,246 Y237* probably null Het
Slc7a14 C T 3: 31,227,063 G366D probably damaging Het
Tbc1d5 A G 17: 50,800,082 V482A probably benign Het
Tdrd5 G T 1: 156,259,935 Q883K probably benign Het
Tet2 T C 3: 133,473,630 Y1258C probably damaging Het
Upf2 A G 2: 6,023,320 D739G unknown Het
Vmn1r122 A T 7: 21,133,895 F78L probably benign Het
Vmn1r75 A T 7: 11,880,988 K216* probably null Het
Vmn2r11 A T 5: 109,053,415 Y408N probably damaging Het
Wscd1 T A 11: 71,788,717 V472D probably damaging Het
Zdbf2 G T 1: 63,306,505 V1348F possibly damaging Het
Zfp442 G T 2: 150,408,136 H615Q possibly damaging Het
Zfp457 C A 13: 67,294,001 C170F possibly damaging Het
Zscan10 A G 17: 23,607,029 probably null Het
Other mutations in Atp6v1b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Atp6v1b2 APN 8 69088934 splice site probably null
IGL00908:Atp6v1b2 APN 8 69096266 missense probably benign 0.00
IGL01914:Atp6v1b2 APN 8 69096280 splice site probably benign
IGL03010:Atp6v1b2 APN 8 69105882 missense probably damaging 0.97
IGL03376:Atp6v1b2 APN 8 69102159 splice site probably benign
R0127:Atp6v1b2 UTSW 8 69103460 missense probably damaging 1.00
R0427:Atp6v1b2 UTSW 8 69101432 missense probably damaging 1.00
R0523:Atp6v1b2 UTSW 8 69109985 missense possibly damaging 0.52
R1754:Atp6v1b2 UTSW 8 69101961 missense probably benign 0.25
R1932:Atp6v1b2 UTSW 8 69102807 nonsense probably null
R1954:Atp6v1b2 UTSW 8 69105903 missense possibly damaging 0.95
R2228:Atp6v1b2 UTSW 8 69102759 splice site probably null
R2229:Atp6v1b2 UTSW 8 69102759 splice site probably null
R4448:Atp6v1b2 UTSW 8 69102022 missense probably benign
R4738:Atp6v1b2 UTSW 8 69103410 missense probably benign
R5243:Atp6v1b2 UTSW 8 69103739 missense probably benign 0.07
R5388:Atp6v1b2 UTSW 8 69101437 missense probably benign 0.00
R5664:Atp6v1b2 UTSW 8 69107620 missense probably damaging 0.99
R5774:Atp6v1b2 UTSW 8 69101961 missense probably damaging 0.97
R5894:Atp6v1b2 UTSW 8 69107566 intron probably null
R6015:Atp6v1b2 UTSW 8 69102496 missense probably damaging 1.00
R6147:Atp6v1b2 UTSW 8 69102482 nonsense probably null
R6217:Atp6v1b2 UTSW 8 69109878 critical splice acceptor site probably null
R6636:Atp6v1b2 UTSW 8 69101374 missense probably damaging 1.00
R6637:Atp6v1b2 UTSW 8 69101374 missense probably damaging 1.00
R7032:Atp6v1b2 UTSW 8 69088896 missense probably benign 0.44
R7108:Atp6v1b2 UTSW 8 69102501 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCATGACCAATGTGCAGACATAC -3'
(R):5'- TTTACCAAACCAGCCTGGCG -3'

Sequencing Primer
(F):5'- GTGCAGACATACTAACATTTTTCCC -3'
(R):5'- CGACAGATCTGAGCTGCAATCTG -3'
Posted On2019-06-26