Incidental Mutation 'R7184:Eddm3b'
ID559198
Institutional Source Beutler Lab
Gene Symbol Eddm3b
Ensembl Gene ENSMUSG00000072575
Gene Nameepididymal protein 3B
SynonymsFam12
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7184 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location51114426-51117807 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 51116930 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 125 (Y125C)
Ref Sequence ENSEMBL: ENSMUSP00000098210 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100645]
Predicted Effect probably damaging
Transcript: ENSMUST00000100645
AA Change: Y125C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098210
Gene: ENSMUSG00000072575
AA Change: Y125C

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:RnaseA 32 147 1.3e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Testicular sperm are morphologically differentiated but are not progressively motile nor able to fertilize an egg. Post-testicular maturation requires exposure of spermatozoa to the microenvironment of the epididymal lumen. Spermatozoa undergo extensive changes in the epididymis, including enzymatic modifications, loss of pre-existing components and addition of new glycoproteins from epididymal secretions. These modifying proteins and enzymes are synthesized by epithelial cells lining the epididymal duct and secreted apically into the lumen, where they come into contact with, and may be absorbed onto, the sperm membranes. The proteins encoded by the genes in this cluster are synthesized and secreted by epididymal epithelial cells. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik T C 1: 93,154,515 N294S probably benign Het
Aass A G 6: 23,094,220 S500P possibly damaging Het
Aldh9a1 T A 1: 167,357,396 N292K probably benign Het
Art2b A T 7: 101,580,451 S80R probably benign Het
Atp6v1b2 G T 8: 69,102,567 A194S possibly damaging Het
Bsnd T C 4: 106,491,912 M44V probably damaging Het
Cadps2 A T 6: 23,583,429 V383E probably benign Het
Cd93 T C 2: 148,442,539 T296A possibly damaging Het
Cdk15 G T 1: 59,265,655 E138D probably benign Het
Cdon A G 9: 35,463,895 I406V probably benign Het
Cyp3a41a A G 5: 145,705,853 V232A probably benign Het
Dbndd1 T A 8: 123,509,121 D130V probably damaging Het
Dnah14 C T 1: 181,704,529 R2294* probably null Het
Enah A T 1: 181,922,392 V294E probably damaging Het
Farp2 A G 1: 93,603,415 E545G probably damaging Het
Farsb T C 1: 78,482,357 E22G possibly damaging Het
Fezf1 A G 6: 23,247,836 V80A probably benign Het
Fpr2 T C 17: 17,893,271 Y39H unknown Het
Fsd1l C A 4: 53,694,054 R344S probably damaging Het
Fuk G A 8: 110,887,156 P758S probably damaging Het
Fxyd1 G T 7: 31,051,976 R90S unknown Het
Galnt4 T A 10: 99,108,604 Y64N probably damaging Het
Gatb C T 3: 85,636,951 Q409* probably null Het
Glipr2 A C 4: 43,968,667 D73A possibly damaging Het
Gm2035 G A 12: 87,919,722 R46W possibly damaging Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gm4788 A G 1: 139,733,084 V622A possibly damaging Het
Gpr88 C T 3: 116,251,994 V223I possibly damaging Het
Gtf2h3 A G 5: 124,584,004 N55S probably benign Het
Htr4 T A 18: 62,437,427 C184* probably null Het
Ighv6-3 T A 12: 114,391,855 R71S probably benign Het
Itpr2 G C 6: 146,311,087 I1510M possibly damaging Het
Keap1 T C 9: 21,233,838 Q292R probably benign Het
Malt1 A C 18: 65,447,693 E219D probably benign Het
Manba T C 3: 135,523,154 V279A possibly damaging Het
Map4k5 T A 12: 69,874,321 H41L probably benign Het
Mcm2 T G 6: 88,891,794 Y327S probably damaging Het
Nectin3 A G 16: 46,395,121 I503T possibly damaging Het
Nqo1 T C 8: 107,392,647 I99M probably damaging Het
Nrxn2 A G 19: 6,490,552 H845R probably damaging Het
Otogl C T 10: 107,763,200 C2254Y probably damaging Het
Pmm1 T C 15: 81,956,214 N110S probably damaging Het
Poc1b G T 10: 99,134,337 C68F probably benign Het
Polr1b A G 2: 129,123,922 Y828C possibly damaging Het
Prl3d1 A G 13: 27,098,636 H119R probably damaging Het
Pum3 A G 19: 27,426,012 S30P probably benign Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Rusc1 T C 3: 89,091,887 E196G possibly damaging Het
Sf3a3 A G 4: 124,714,979 K29E probably benign Het
Slc13a1 A T 6: 24,092,312 I475K probably damaging Het
Slc26a5 G T 5: 21,837,246 Y237* probably null Het
Slc7a14 C T 3: 31,227,063 G366D probably damaging Het
Tbc1d5 A G 17: 50,800,082 V482A probably benign Het
Tdrd5 G T 1: 156,259,935 Q883K probably benign Het
Tet2 T C 3: 133,473,630 Y1258C probably damaging Het
Upf2 A G 2: 6,023,320 D739G unknown Het
Vmn1r122 A T 7: 21,133,895 F78L probably benign Het
Vmn1r75 A T 7: 11,880,988 K216* probably null Het
Vmn2r11 A T 5: 109,053,415 Y408N probably damaging Het
Wscd1 T A 11: 71,788,717 V472D probably damaging Het
Zdbf2 G T 1: 63,306,505 V1348F possibly damaging Het
Zfp442 G T 2: 150,408,136 H615Q possibly damaging Het
Zfp457 C A 13: 67,294,001 C170F possibly damaging Het
Zscan10 A G 17: 23,607,029 probably null Het
Other mutations in Eddm3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02025:Eddm3b APN 14 51116771 missense probably damaging 1.00
IGL02084:Eddm3b APN 14 51116630 missense unknown
IGL03371:Eddm3b APN 14 51116965 missense probably damaging 0.97
R1902:Eddm3b UTSW 14 51116864 missense probably damaging 1.00
R4473:Eddm3b UTSW 14 51116779 missense probably benign 0.01
R5269:Eddm3b UTSW 14 51116721 missense probably damaging 1.00
X0064:Eddm3b UTSW 14 51116999 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCAAGCTCTCACACATGTTTG -3'
(R):5'- CTGACAGACAATTGCAAAGCAG -3'

Sequencing Primer
(F):5'- GCTCTCACACATGTTTGTTTATATG -3'
(R):5'- TAACTATTGTAAGCAGGGGGTG -3'
Posted On2019-06-26