Incidental Mutation 'R7184:Malt1'
ID559205
Institutional Source Beutler Lab
Gene Symbol Malt1
Ensembl Gene ENSMUSG00000032688
Gene NameMALT1 paracaspase
Synonymsparacaspase, D430033E09Rik
MMRRC Submission
Accession Numbers

Genbank: NM_172833

Is this an essential gene? Possibly non essential (E-score: 0.322) question?
Stock #R7184 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location65430962-65478823 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 65447693 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 219 (E219D)
Ref Sequence ENSEMBL: ENSMUSP00000048376 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049248] [ENSMUST00000224056]
Predicted Effect probably benign
Transcript: ENSMUST00000049248
AA Change: E219D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000048376
Gene: ENSMUSG00000032688
AA Change: E219D

DomainStartEndE-ValueType
low complexity region 19 35 N/A INTRINSIC
low complexity region 38 51 N/A INTRINSIC
PDB:2G7R|B 52 132 3e-29 PDB
IGc2 145 203 8.19e-9 SMART
IGc2 248 306 2.88e-4 SMART
Pfam:Peptidase_C14 340 557 1.4e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000224056
AA Change: E219D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene has been found to be recurrently rearranged in chromosomal translocation with two other genes - baculoviral IAP repeat-containing protein 3 (also known as apoptosis inhibitor 2) and immunoglobulin heavy chain locus - in mucosa-associated lymphoid tissue lymphomas. The protein encoded by this gene may play a role in NF-kappaB activation. Two alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene disrupts normal B cell development and leads to impaired cytokine production and T cell and B cell proliferative responses after antigen receptor engagement due to failure of NF-kappaB activation. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, knock-out(2) Targeted, other(2) Gene trapped(3)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik T C 1: 93,154,515 N294S probably benign Het
Aass A G 6: 23,094,220 S500P possibly damaging Het
Aldh9a1 T A 1: 167,357,396 N292K probably benign Het
Art2b A T 7: 101,580,451 S80R probably benign Het
Atp6v1b2 G T 8: 69,102,567 A194S possibly damaging Het
Bsnd T C 4: 106,491,912 M44V probably damaging Het
Cadps2 A T 6: 23,583,429 V383E probably benign Het
Cd93 T C 2: 148,442,539 T296A possibly damaging Het
Cdk15 G T 1: 59,265,655 E138D probably benign Het
Cdon A G 9: 35,463,895 I406V probably benign Het
Cyp3a41a A G 5: 145,705,853 V232A probably benign Het
Dbndd1 T A 8: 123,509,121 D130V probably damaging Het
Dnah14 C T 1: 181,704,529 R2294* probably null Het
Eddm3b A G 14: 51,116,930 Y125C probably damaging Het
Enah A T 1: 181,922,392 V294E probably damaging Het
Farp2 A G 1: 93,603,415 E545G probably damaging Het
Farsb T C 1: 78,482,357 E22G possibly damaging Het
Fezf1 A G 6: 23,247,836 V80A probably benign Het
Fpr2 T C 17: 17,893,271 Y39H unknown Het
Fsd1l C A 4: 53,694,054 R344S probably damaging Het
Fuk G A 8: 110,887,156 P758S probably damaging Het
Fxyd1 G T 7: 31,051,976 R90S unknown Het
Galnt4 T A 10: 99,108,604 Y64N probably damaging Het
Gatb C T 3: 85,636,951 Q409* probably null Het
Glipr2 A C 4: 43,968,667 D73A possibly damaging Het
Gm2035 G A 12: 87,919,722 R46W possibly damaging Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gm4788 A G 1: 139,733,084 V622A possibly damaging Het
Gpr88 C T 3: 116,251,994 V223I possibly damaging Het
Gtf2h3 A G 5: 124,584,004 N55S probably benign Het
Htr4 T A 18: 62,437,427 C184* probably null Het
Ighv6-3 T A 12: 114,391,855 R71S probably benign Het
Itpr2 G C 6: 146,311,087 I1510M possibly damaging Het
Keap1 T C 9: 21,233,838 Q292R probably benign Het
Manba T C 3: 135,523,154 V279A possibly damaging Het
Map4k5 T A 12: 69,874,321 H41L probably benign Het
Mcm2 T G 6: 88,891,794 Y327S probably damaging Het
Nectin3 A G 16: 46,395,121 I503T possibly damaging Het
Nqo1 T C 8: 107,392,647 I99M probably damaging Het
Nrxn2 A G 19: 6,490,552 H845R probably damaging Het
Otogl C T 10: 107,763,200 C2254Y probably damaging Het
Pmm1 T C 15: 81,956,214 N110S probably damaging Het
Poc1b G T 10: 99,134,337 C68F probably benign Het
Polr1b A G 2: 129,123,922 Y828C possibly damaging Het
Prl3d1 A G 13: 27,098,636 H119R probably damaging Het
Pum3 A G 19: 27,426,012 S30P probably benign Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Rusc1 T C 3: 89,091,887 E196G possibly damaging Het
Sf3a3 A G 4: 124,714,979 K29E probably benign Het
Slc13a1 A T 6: 24,092,312 I475K probably damaging Het
Slc26a5 G T 5: 21,837,246 Y237* probably null Het
Slc7a14 C T 3: 31,227,063 G366D probably damaging Het
Tbc1d5 A G 17: 50,800,082 V482A probably benign Het
Tdrd5 G T 1: 156,259,935 Q883K probably benign Het
Tet2 T C 3: 133,473,630 Y1258C probably damaging Het
Upf2 A G 2: 6,023,320 D739G unknown Het
Vmn1r122 A T 7: 21,133,895 F78L probably benign Het
Vmn1r75 A T 7: 11,880,988 K216* probably null Het
Vmn2r11 A T 5: 109,053,415 Y408N probably damaging Het
Wscd1 T A 11: 71,788,717 V472D probably damaging Het
Zdbf2 G T 1: 63,306,505 V1348F possibly damaging Het
Zfp442 G T 2: 150,408,136 H615Q possibly damaging Het
Zfp457 C A 13: 67,294,001 C170F possibly damaging Het
Zscan10 A G 17: 23,607,029 probably null Het
Other mutations in Malt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Malt1 APN 18 65448963 nonsense probably null
IGL01354:Malt1 APN 18 65475191 missense probably damaging 1.00
IGL01514:Malt1 APN 18 65476400 missense possibly damaging 0.74
IGL01968:Malt1 APN 18 65449016 missense probably benign 0.08
bryce_canyon UTSW 18 65462915 critical splice donor site probably null
mousebird UTSW 18 65475260 critical splice donor site probably null
yellowstone UTSW 18 65458200 missense probably damaging 1.00
H8930:Malt1 UTSW 18 65462815 nonsense probably null
R0319:Malt1 UTSW 18 65462915 critical splice donor site probably null
R0512:Malt1 UTSW 18 65458200 missense probably damaging 1.00
R0748:Malt1 UTSW 18 65475260 critical splice donor site probably null
R2085:Malt1 UTSW 18 65473147 missense probably damaging 1.00
R2962:Malt1 UTSW 18 65448335 missense probably benign 0.01
R4193:Malt1 UTSW 18 65447675 missense probably benign 0.00
R4359:Malt1 UTSW 18 65476229 missense probably benign 0.00
R4913:Malt1 UTSW 18 65476280 missense probably damaging 1.00
R5201:Malt1 UTSW 18 65476055 missense probably benign
R5925:Malt1 UTSW 18 65431368 missense possibly damaging 0.86
R6944:Malt1 UTSW 18 65437920 missense probably benign 0.08
R7108:Malt1 UTSW 18 65464051 missense probably damaging 1.00
R7192:Malt1 UTSW 18 65437827 missense probably benign 0.07
R7307:Malt1 UTSW 18 65451569 missense possibly damaging 0.48
R7308:Malt1 UTSW 18 65449609 critical splice donor site probably null
R7490:Malt1 UTSW 18 65448211 missense probably benign 0.04
R7558:Malt1 UTSW 18 65462834 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAAATCTTCACGCATACCCTC -3'
(R):5'- CACAGACATTAGCAGGTTCAAGC -3'

Sequencing Primer
(F):5'- AAATCTTCACGCATACCCTCTTATTG -3'
(R):5'- CATTAGCAGGTTCAAGCTGAGCATC -3'
Posted On2019-06-26