Incidental Mutation 'R0590:BC017158'
ID55926
Institutional Source Beutler Lab
Gene Symbol BC017158
Ensembl Gene ENSMUSG00000030780
Gene NamecDNA sequence BC017158
SynonymsMGC:28903
MMRRC Submission 038780-MU
Accession Numbers

Genbank: NM_145590; MGI: 2384572

Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R0590 (G1)
Quality Score215
Status Validated
Chromosome7
Chromosomal Location128271379-128298170 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 128297470 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 134 (L134P)
Ref Sequence ENSEMBL: ENSMUSP00000033044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033044] [ENSMUST00000126263]
Predicted Effect probably damaging
Transcript: ENSMUST00000033044
AA Change: L134P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000033044
Gene: ENSMUSG00000030780
AA Change: L134P

DomainStartEndE-ValueType
Pfam:DUF647 62 301 5.6e-97 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000126263
AA Change: L134P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000114673
Gene: ENSMUSG00000030780
AA Change: L134P

DomainStartEndE-ValueType
Pfam:DUF647 61 304 3e-102 PFAM
low complexity region 334 347 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139452
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154003
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155177
Meta Mutation Damage Score 0.328 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.7%
  • 20x: 95.7%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a putative transmembrane protein containing a conserved DUF647 domain that may be involved in protein-protein interaction. The encoded protein is related to a plant protein that participates in ultraviolet B light-sensing during root morphogenesis. [provided by RefSeq, Feb 2013]
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acnat2 C T 4: 49,383,273 M93I probably benign Het
Adamts16 T C 13: 70,800,954 D196G probably benign Het
Adhfe1 T A 1: 9,548,153 probably null Het
AI661453 A G 17: 47,467,074 probably benign Het
Apc G T 18: 34,316,230 E2026* probably null Het
Atg2a GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC 19: 6,245,007 probably benign Het
Cad T C 5: 31,062,231 S688P probably damaging Het
Ccdc191 C T 16: 43,931,341 R345* probably null Het
Dcaf13 T A 15: 39,145,085 probably benign Het
Drc1 A G 5: 30,363,136 D607G probably benign Het
Fam160a1 T C 3: 85,672,376 R841G probably benign Het
Gli1 G T 10: 127,331,563 A607E possibly damaging Het
Gls G A 1: 52,212,375 probably benign Het
Gria1 A T 11: 57,289,409 Q728H probably damaging Het
Hcrtr1 A G 4: 130,135,694 L198P probably damaging Het
Ifngr1 T A 10: 19,603,942 probably benign Het
Ipo5 T C 14: 120,944,357 V954A possibly damaging Het
Kcnh5 G T 12: 74,965,261 A628D probably damaging Het
Kif14 T C 1: 136,482,472 S646P probably damaging Het
Ksr1 A G 11: 79,045,140 S133P probably damaging Het
Neb T C 2: 52,137,290 M7143V probably damaging Het
Nelfa G A 5: 33,901,825 P229S probably damaging Het
Nfatc2 T C 2: 168,571,199 T169A probably damaging Het
Nr1h4 A G 10: 89,456,567 Y398H probably damaging Het
Nrcam A G 12: 44,564,032 E511G probably damaging Het
Ocstamp T A 2: 165,397,751 R172W probably damaging Het
Olfr1130 A G 2: 87,607,994 E202G probably damaging Het
Olfr26 T A 9: 38,855,470 M136K probably damaging Het
Olfr27 T C 9: 39,144,721 V207A probably benign Het
Phf14 G A 6: 11,961,578 V405I possibly damaging Het
Plk5 G A 10: 80,360,223 R238H probably damaging Het
Pole A G 5: 110,317,926 E1240G probably benign Het
Prdm15 A G 16: 97,797,761 I899T possibly damaging Het
Psip1 T C 4: 83,458,144 N486S probably benign Het
Rlf A G 4: 121,170,833 probably benign Het
Rttn T C 18: 88,979,635 S255P probably damaging Het
Sema6c A G 3: 95,172,623 K711E probably damaging Het
Slc4a10 A T 2: 62,190,893 probably benign Het
Trim36 T G 18: 46,172,576 S435R probably benign Het
Ucp1 A G 8: 83,291,603 probably benign Het
Vmn1r17 T C 6: 57,361,014 Y122C probably benign Het
Vmn1r23 A G 6: 57,926,364 V143A probably benign Het
Wdfy4 T A 14: 33,041,174 Q2166L probably benign Het
Zc3h7b C T 15: 81,776,998 T346M possibly damaging Het
Zfhx4 T A 3: 5,402,633 V2617D probably damaging Het
Other mutations in BC017158
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02451:BC017158 APN 7 128276410 missense probably damaging 1.00
IGL02527:BC017158 APN 7 128276231 missense possibly damaging 0.92
IGL02572:BC017158 APN 7 128290580 splice site probably benign
3-1:BC017158 UTSW 7 128276129 missense possibly damaging 0.87
PIT4445001:BC017158 UTSW 7 128276534 missense probably benign 0.15
R0364:BC017158 UTSW 7 128290614 missense probably damaging 1.00
R0616:BC017158 UTSW 7 128272631 intron probably null
R2060:BC017158 UTSW 7 128288331 missense probably damaging 1.00
R3849:BC017158 UTSW 7 128285208 missense probably damaging 1.00
R4487:BC017158 UTSW 7 128288358 missense probably damaging 1.00
R4510:BC017158 UTSW 7 128276140 missense probably damaging 0.99
R4511:BC017158 UTSW 7 128276140 missense probably damaging 0.99
R4708:BC017158 UTSW 7 128274680 missense probably benign 0.00
R4793:BC017158 UTSW 7 128288202 intron probably benign
R4983:BC017158 UTSW 7 128276473 unclassified probably benign
R5502:BC017158 UTSW 7 128285136 missense probably damaging 1.00
R6181:BC017158 UTSW 7 128297460 critical splice donor site probably null
R6312:BC017158 UTSW 7 128273543 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TTCACTGATGAGGGCATTCCAGC -3'
(R):5'- GTTTTCCAGGTCCCACAGAACCAG -3'

Sequencing Primer
(F):5'- TGGGCAAAGATTCACAGCTTC -3'
(R):5'- CCAGTGAGAGCTGGTATAGCAC -3'
Posted On2013-07-11