Incidental Mutation 'R7185:Sec11c'
ID559269
Institutional Source Beutler Lab
Gene Symbol Sec11c
Ensembl Gene ENSMUSG00000024516
Gene NameSEC11 homolog C, signal peptidase complex subunit
Synonyms1810029G24Rik, Sec11l3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7185 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location65800549-65817665 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 65814892 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 134 (D134E)
Ref Sequence ENSEMBL: ENSMUSP00000025394 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025394] [ENSMUST00000126432] [ENSMUST00000153193]
Predicted Effect probably damaging
Transcript: ENSMUST00000025394
AA Change: D134E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025394
Gene: ENSMUSG00000024516
AA Change: D134E

DomainStartEndE-ValueType
transmembrane domain 34 56 N/A INTRINSIC
Pfam:Peptidase_S24 63 135 1.6e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126432
SMART Domains Protein: ENSMUSP00000122624
Gene: ENSMUSG00000024516

DomainStartEndE-ValueType
transmembrane domain 34 56 N/A INTRINSIC
Pfam:Peptidase_S24 63 98 6.8e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153193
SMART Domains Protein: ENSMUSP00000122547
Gene: ENSMUSG00000024516

DomainStartEndE-ValueType
transmembrane domain 48 70 N/A INTRINSIC
SCOP:d1b12a_ 76 98 1e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (63/63)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600002K03Rik G A 10: 80,173,129 G55E probably damaging Het
2610044O15Rik8 A T 8: 129,220,021 C108S probably benign Het
4930430F08Rik T C 10: 100,589,211 probably benign Het
Afmid T A 11: 117,834,773 D95E possibly damaging Het
Ak7 A G 12: 105,742,276 E330G probably damaging Het
B3gat2 A C 1: 23,763,191 D186A probably damaging Het
Baz1a G A 12: 54,975,308 T63M probably damaging Het
Bhmt2 A T 13: 93,663,271 M219K probably benign Het
Cd200r1 A G 16: 44,789,612 T65A probably benign Het
Cdc14a T C 3: 116,294,027 E494G probably benign Het
Cenpf A G 1: 189,653,489 L2198P probably damaging Het
Col4a2 T A 8: 11,399,739 D117E probably damaging Het
Ddr2 C A 1: 169,987,054 V607L probably damaging Het
Dennd4c A G 4: 86,811,450 Y763C probably damaging Het
Ecscr T A 18: 35,716,804 T93S probably benign Het
Eogt C T 6: 97,120,178 R321H probably damaging Het
Fras1 T C 5: 96,636,776 S873P probably damaging Het
Gm29735 ACAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAACAGCAGGATTCGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAAGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCA ACAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAACAGCAGGATTCGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAAGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCA 7: 142,156,529 probably benign Het
Gm8247 A G 14: 44,586,402 I182V Het
Gpatch2 T C 1: 187,226,197 S250P probably damaging Het
Gramd1b T C 9: 40,333,563 D183G probably benign Het
Hspa5 T C 2: 34,775,126 V433A probably damaging Het
Igkv8-30 C A 6: 70,117,606 Q4H probably benign Het
Igkv8-30 T G 6: 70,117,607 Q4P probably damaging Het
Kcnj5 T G 9: 32,322,176 N281T probably damaging Het
L1td1 A G 4: 98,736,618 E350G possibly damaging Het
Layn T C 9: 51,073,873 T128A possibly damaging Het
Liph T C 16: 21,995,339 M11V probably benign Het
Lrp1b C T 2: 40,801,512 probably null Het
Mcrip1 A C 11: 120,544,679 probably null Het
Myh1 G A 11: 67,207,459 E486K probably damaging Het
Nav1 T C 1: 135,471,008 K612R possibly damaging Het
Nek10 A G 14: 14,846,621 K245E probably benign Het
Nipal1 T A 5: 72,666,855 S181T probably damaging Het
Nme8 A C 13: 19,677,883 L192R probably damaging Het
Nol7 G A 13: 43,406,831 probably null Het
Oas1b G A 5: 120,817,772 R205H not run Het
Olfr1138 A G 2: 87,738,145 Y60H probably damaging Het
Olfr1305 T G 2: 111,873,822 E11A possibly damaging Het
Olfr71 A G 4: 43,706,082 I162T possibly damaging Het
Pcdhgb6 T C 18: 37,743,648 S470P probably benign Het
Pdzk1ip1 A T 4: 115,089,108 H55L possibly damaging Het
Pibf1 T A 14: 99,107,316 M124K possibly damaging Het
Prr36 C T 8: 4,216,458 G31R probably damaging Het
Ptchd4 C A 17: 42,503,188 A660D probably damaging Het
Qsox2 A G 2: 26,220,706 V166A possibly damaging Het
Rb1cc1 A T 1: 6,238,383 Y164F probably damaging Het
Rest C A 5: 77,282,484 H917N probably benign Het
Rnf213 T C 11: 119,424,198 C955R Het
Scn7a T A 2: 66,687,795 N1024I possibly damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Spo11 T A 2: 172,982,192 probably null Het
Srd5a3 T C 5: 76,153,572 I216T probably benign Het
Tcaf3 T C 6: 42,593,930 N296S probably benign Het
Tepsin T C 11: 120,093,817 D259G probably damaging Het
Themis G A 10: 28,781,877 S300N probably benign Het
Trhr2 T A 8: 122,360,657 T15S probably benign Het
Uts2r T C 11: 121,160,880 V190A probably benign Het
Vmn2r77 A C 7: 86,801,827 D307A probably benign Het
Xpa G T 4: 46,183,078 T237K probably benign Het
Zfp335 A G 2: 164,893,244 probably null Het
Zfp451 A T 1: 33,769,893 D962E probably damaging Het
Zfp60 A G 7: 27,738,405 T46A probably damaging Het
Zfy1 G A Y: 725,464 S767L possibly damaging Het
Other mutations in Sec11c
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1912:Sec11c UTSW 18 65814874 missense probably damaging 1.00
R2114:Sec11c UTSW 18 65800649 missense probably benign 0.00
R2115:Sec11c UTSW 18 65800649 missense probably benign 0.00
R2116:Sec11c UTSW 18 65800649 missense probably benign 0.00
R2117:Sec11c UTSW 18 65800649 missense probably benign 0.00
R4869:Sec11c UTSW 18 65801470 missense probably benign 0.00
R7161:Sec11c UTSW 18 65812732 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CAGCCGGGTGGTTATCTGTAAG -3'
(R):5'- AGCACTCCTGATGTGTCATG -3'

Sequencing Primer
(F):5'- CGGGTGGTTATCTGTAAGCAATCAAC -3'
(R):5'- GTCATGTGACAAACGACTCTATTCTC -3'
Posted On2019-06-26