Incidental Mutation 'R0590:Ucp1'
ID55927
Institutional Source Beutler Lab
Gene Symbol Ucp1
Ensembl Gene ENSMUSG00000031710
Gene Nameuncoupling protein 1 (mitochondrial, proton carrier)
SynonymsSlc25a7
MMRRC Submission 038780-MU
Accession Numbers

Ncbi RefSeq: NM_009463.3; MGI: 98894

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0590 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location83290352-83298452 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 83291603 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000034146 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034146]
Predicted Effect probably benign
Transcript: ENSMUST00000034146
SMART Domains Protein: ENSMUSP00000034146
Gene: ENSMUSG00000031710

DomainStartEndE-ValueType
Pfam:Mito_carr 10 107 5.7e-20 PFAM
Pfam:Mito_carr 109 206 3.3e-20 PFAM
Pfam:Mito_carr 209 300 1.6e-18 PFAM
Meta Mutation Damage Score 0.1188 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.7%
  • 20x: 95.7%
Validation Efficiency 100% (47/47)
MGI Phenotype Strain: 1857471
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mitochondrial uncoupling proteins (UCP) are members of the family of mitochondrial anion carrier proteins (MACP). UCPs separate oxidative phosphorylation from ATP synthesis with energy dissipated as heat, also referred to as the mitochondrial proton leak. UCPs facilitate the transfer of anions from the inner to the outer mitochondrial membrane and the return transfer of protons from the outer to the inner mitochondrial membrane. They also reduce the mitochondrial membrane potential in mammalian cells. Tissue specificity occurs for the different UCPs and the exact methods of how UCPs transfer H+/OH- are not known. UCPs contain the three homologous protein domains of MACPs. This gene is expressed only in brown adipose tissue, a specialized tissue which functions to produce heat. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants exhibit impaired thermoregulation on some genetic backgrounds. Biochemical alterations in brown fat mitochondria are also observed. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(2) Spontaneous(1)

Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acnat2 C T 4: 49,383,273 M93I probably benign Het
Adamts16 T C 13: 70,800,954 D196G probably benign Het
Adhfe1 T A 1: 9,548,153 probably null Het
AI661453 A G 17: 47,467,074 probably benign Het
Apc G T 18: 34,316,230 E2026* probably null Het
Atg2a GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC 19: 6,245,007 probably benign Het
BC017158 A G 7: 128,297,470 L134P probably damaging Het
Cad T C 5: 31,062,231 S688P probably damaging Het
Ccdc191 C T 16: 43,931,341 R345* probably null Het
Dcaf13 T A 15: 39,145,085 probably benign Het
Drc1 A G 5: 30,363,136 D607G probably benign Het
Fam160a1 T C 3: 85,672,376 R841G probably benign Het
Gli1 G T 10: 127,331,563 A607E possibly damaging Het
Gls G A 1: 52,212,375 probably benign Het
Gria1 A T 11: 57,289,409 Q728H probably damaging Het
Hcrtr1 A G 4: 130,135,694 L198P probably damaging Het
Ifngr1 T A 10: 19,603,942 probably benign Het
Ipo5 T C 14: 120,944,357 V954A possibly damaging Het
Kcnh5 G T 12: 74,965,261 A628D probably damaging Het
Kif14 T C 1: 136,482,472 S646P probably damaging Het
Ksr1 A G 11: 79,045,140 S133P probably damaging Het
Neb T C 2: 52,137,290 M7143V probably damaging Het
Nelfa G A 5: 33,901,825 P229S probably damaging Het
Nfatc2 T C 2: 168,571,199 T169A probably damaging Het
Nr1h4 A G 10: 89,456,567 Y398H probably damaging Het
Nrcam A G 12: 44,564,032 E511G probably damaging Het
Ocstamp T A 2: 165,397,751 R172W probably damaging Het
Olfr1130 A G 2: 87,607,994 E202G probably damaging Het
Olfr26 T A 9: 38,855,470 M136K probably damaging Het
Olfr27 T C 9: 39,144,721 V207A probably benign Het
Phf14 G A 6: 11,961,578 V405I possibly damaging Het
Plk5 G A 10: 80,360,223 R238H probably damaging Het
Pole A G 5: 110,317,926 E1240G probably benign Het
Prdm15 A G 16: 97,797,761 I899T possibly damaging Het
Psip1 T C 4: 83,458,144 N486S probably benign Het
Rlf A G 4: 121,170,833 probably benign Het
Rttn T C 18: 88,979,635 S255P probably damaging Het
Sema6c A G 3: 95,172,623 K711E probably damaging Het
Slc4a10 A T 2: 62,190,893 probably benign Het
Trim36 T G 18: 46,172,576 S435R probably benign Het
Vmn1r17 T C 6: 57,361,014 Y122C probably benign Het
Vmn1r23 A G 6: 57,926,364 V143A probably benign Het
Wdfy4 T A 14: 33,041,174 Q2166L probably benign Het
Zc3h7b C T 15: 81,776,998 T346M possibly damaging Het
Zfhx4 T A 3: 5,402,633 V2617D probably damaging Het
Other mutations in Ucp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4585001:Ucp1 UTSW 8 83293948 missense probably damaging 1.00
R0050:Ucp1 UTSW 8 83294228 missense probably damaging 1.00
R0055:Ucp1 UTSW 8 83290604 nonsense probably null
R0055:Ucp1 UTSW 8 83290604 nonsense probably null
R0505:Ucp1 UTSW 8 83295307 missense possibly damaging 0.78
R0681:Ucp1 UTSW 8 83295307 missense possibly damaging 0.78
R0731:Ucp1 UTSW 8 83297847 splice site probably benign
R1606:Ucp1 UTSW 8 83295304 missense probably damaging 1.00
R1722:Ucp1 UTSW 8 83290688 missense probably benign 0.25
R1809:Ucp1 UTSW 8 83297867 missense probably damaging 0.99
R1823:Ucp1 UTSW 8 83294032 missense probably damaging 1.00
R3809:Ucp1 UTSW 8 83290641 missense probably damaging 0.99
R4085:Ucp1 UTSW 8 83293951 missense probably benign 0.43
R4673:Ucp1 UTSW 8 83295247 missense probably damaging 1.00
R4998:Ucp1 UTSW 8 83297855 critical splice acceptor site probably null
R5163:Ucp1 UTSW 8 83294203 missense possibly damaging 0.95
R5421:Ucp1 UTSW 8 83290691 missense probably benign 0.12
R5790:Ucp1 UTSW 8 83297891 missense possibly damaging 0.54
R5994:Ucp1 UTSW 8 83293938 missense possibly damaging 0.92
R6574:Ucp1 UTSW 8 83294089 critical splice donor site probably null
R6732:Ucp1 UTSW 8 83291477 missense probably benign 0.08
R7282:Ucp1 UTSW 8 83293902 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ATGGACAGCCACTTCTCTCTGACC -3'
(R):5'- AGCTCTCTAAGCTTCTCTGGGACC -3'

Sequencing Primer
(F):5'- CAGGCTTCCAGTACCATTAGG -3'
(R):5'- ACCGTGCTGTTTGGGAAAG -3'
Posted On2013-07-11