Incidental Mutation 'R7186:Usp32'
ID559307
Institutional Source Beutler Lab
Gene Symbol Usp32
Ensembl Gene ENSMUSG00000000804
Gene Nameubiquitin specific peptidase 32
Synonyms6430526O11Rik, 2900074J03Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7186 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location84984442-85140161 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 85051234 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 344 (V344E)
Ref Sequence ENSEMBL: ENSMUSP00000103710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108075]
Predicted Effect probably benign
Transcript: ENSMUST00000108075
AA Change: V344E

PolyPhen 2 Score 0.449 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000103710
Gene: ENSMUSG00000000804
AA Change: V344E

DomainStartEndE-ValueType
EFh 232 260 4.66e0 SMART
EFh 268 296 5.8e-1 SMART
Blast:EFh 318 346 5e-7 BLAST
DUSP 389 588 2.32e-16 SMART
Pfam:Ubiquitin_3 628 711 2.4e-9 PFAM
Pfam:UCH 733 1564 2.4e-83 PFAM
Pfam:UCH_1 1202 1547 2.9e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 T A 11: 49,019,273 I778F possibly damaging Het
Adam39 A T 8: 40,826,312 N580I probably damaging Het
Adamts20 A G 15: 94,322,808 S1415P possibly damaging Het
Adcy2 A G 13: 68,668,639 Y743H probably damaging Het
Aldh1a3 A G 7: 66,406,083 V320A probably damaging Het
Arid1a TGCCGCCGCCGCCGCCGCCGCCG TGCCGCCGCCGCCGCCGCCG 4: 133,753,233 Het
Art5 G T 7: 102,097,329 R268S probably benign Het
Bfar T C 16: 13,692,507 V238A probably benign Het
Card6 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG 15: 5,098,691 probably benign Het
Cdc23 G A 18: 34,637,122 T408I probably damaging Het
Cdh24 G C 14: 54,633,492 P522A probably benign Het
Clrn2 T C 5: 45,453,773 probably benign Het
Cyp2j8 T C 4: 96,475,550 D292G probably benign Het
Deaf1 T C 7: 141,327,470 E34G probably benign Het
Elovl7 A G 13: 108,271,848 E127G probably damaging Het
Fam46b T A 4: 133,486,207 F130I probably damaging Het
Flg A T 3: 93,279,945 R235* probably null Het
Gbp3 G A 3: 142,564,162 V77M probably damaging Het
Gda A T 19: 21,395,205 F450I probably benign Het
Gipc1 A G 8: 83,664,133 E289G possibly damaging Het
Gm21731 C T 13: 120,241,051 L128F probably damaging Het
Gm4924 T C 10: 82,378,944 Y859H unknown Het
Gpatch1 A T 7: 35,295,313 D509E possibly damaging Het
Gpbp1 A G 13: 111,440,699 V219A possibly damaging Het
Gpr107 A T 2: 31,152,359 M1L possibly damaging Het
Heg1 T C 16: 33,731,664 F1003L probably damaging Het
Hivep1 A G 13: 42,156,338 T685A probably benign Het
Hpse T A 5: 100,695,529 D259V probably damaging Het
Ighv14-1 T C 12: 113,932,029 D92G probably damaging Het
Lsp1 T C 7: 142,490,352 V278A probably damaging Het
Lurap1l C A 4: 80,911,510 S52R possibly damaging Het
Luzp2 A G 7: 54,835,829 probably benign Het
Micall1 A G 15: 79,125,375 E399G unknown Het
Ncapd2 A G 6: 125,186,156 S130P possibly damaging Het
Nrg2 A G 18: 36,045,920 V321A probably benign Het
Nuf2 T C 1: 169,525,385 H17R probably damaging Het
Numb A G 12: 83,796,146 W419R probably damaging Het
Olfr1318 T A 2: 112,156,162 D70E probably damaging Het
Olfr462 G A 11: 87,889,765 L44F possibly damaging Het
Olfr681 A G 7: 105,122,266 R270G probably benign Het
Pde6a T A 18: 61,220,606 M1K probably null Het
Pknox1 C T 17: 31,603,198 A313V probably damaging Het
Ppp2ca T A 11: 52,119,253 N229K possibly damaging Het
Ptgdr A T 14: 44,858,944 C104S probably damaging Het
Ralgapa2 C A 2: 146,388,486 probably null Het
Rfx5 G T 3: 94,958,348 K319N probably benign Het
Rnase10 A T 14: 51,009,785 T207S probably damaging Het
Rreb1 A G 13: 37,941,632 T1305A probably benign Het
Rrp12 C A 19: 41,871,305 probably null Het
Rubcnl A C 14: 75,032,013 D37A possibly damaging Het
Scn9a T C 2: 66,534,223 Y802C probably damaging Het
Sec16a A T 2: 26,440,703 Y433* probably null Het
Sirt7 C T 11: 120,620,485 R280H probably benign Het
Snx13 G C 12: 35,092,913 R252S probably damaging Het
Stk32b G T 5: 37,466,781 D207E probably damaging Het
Sult2a7 C T 7: 14,470,053 V262I not run Het
Tex45 T C 8: 3,479,049 F208S probably damaging Het
Tmem33 G C 5: 67,263,787 V35L possibly damaging Het
Uba1y A G Y: 825,537 I300V probably benign Het
Usp50 C T 2: 126,783,298 probably benign Het
Vmn1r238 A C 18: 3,122,661 F251C probably damaging Het
Vmn2r74 A T 7: 85,951,942 Y829* probably null Het
Wars A G 12: 108,881,056 F141L probably damaging Het
Zfp879 A G 11: 50,833,794 V145A probably benign Het
Zfp934 A T 13: 62,492,390 V56D probably benign Het
Other mutations in Usp32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00529:Usp32 APN 11 84994426 missense probably damaging 1.00
IGL00701:Usp32 APN 11 85059125 splice site probably null
IGL00848:Usp32 APN 11 85051181 splice site probably benign
IGL00934:Usp32 APN 11 85007076 missense probably damaging 1.00
IGL01019:Usp32 APN 11 85039265 missense probably damaging 0.97
IGL01302:Usp32 APN 11 84988482 missense probably benign 0.05
IGL01444:Usp32 APN 11 85059164 missense probably damaging 0.97
IGL01575:Usp32 APN 11 85022802 missense probably damaging 1.00
IGL01981:Usp32 APN 11 85036524 missense probably benign 0.02
IGL02118:Usp32 APN 11 85032177 nonsense probably null
IGL02159:Usp32 APN 11 85005802 splice site probably null
IGL02227:Usp32 APN 11 84986481 missense probably damaging 1.00
IGL02363:Usp32 APN 11 85044787 missense probably benign 0.01
IGL02524:Usp32 APN 11 85010011 nonsense probably null
IGL02613:Usp32 APN 11 85040070 missense probably damaging 0.99
IGL02720:Usp32 APN 11 85006991 critical splice donor site probably null
IGL02738:Usp32 APN 11 85083806 missense probably damaging 1.00
IGL02929:Usp32 APN 11 84988372 missense probably benign 0.01
IGL03303:Usp32 APN 11 85022832 missense probably damaging 1.00
PIT4812001:Usp32 UTSW 11 85010074 missense probably damaging 1.00
R0026:Usp32 UTSW 11 85032074 missense possibly damaging 0.48
R0295:Usp32 UTSW 11 85053692 missense probably damaging 0.98
R1320:Usp32 UTSW 11 85017793 missense probably damaging 0.98
R1712:Usp32 UTSW 11 85042580 missense probably benign 0.12
R1922:Usp32 UTSW 11 85007004 nonsense probably null
R1973:Usp32 UTSW 11 85103931 missense probably benign 0.09
R2010:Usp32 UTSW 11 85040004 missense probably damaging 0.98
R2082:Usp32 UTSW 11 85030512 missense probably damaging 0.99
R2355:Usp32 UTSW 11 85005909 missense probably benign 0.34
R3147:Usp32 UTSW 11 85029087 missense probably damaging 1.00
R3160:Usp32 UTSW 11 85025536 missense probably damaging 0.97
R3162:Usp32 UTSW 11 85025536 missense probably damaging 0.97
R3716:Usp32 UTSW 11 85042563 missense probably damaging 1.00
R3816:Usp32 UTSW 11 84994384 critical splice donor site probably null
R3870:Usp32 UTSW 11 85007055 nonsense probably null
R3871:Usp32 UTSW 11 85081156 missense probably null 0.81
R4041:Usp32 UTSW 11 85017739 missense probably benign 0.40
R4079:Usp32 UTSW 11 85039229 missense probably damaging 0.98
R4332:Usp32 UTSW 11 85103978 missense possibly damaging 0.79
R4396:Usp32 UTSW 11 85053975 missense probably benign
R4580:Usp32 UTSW 11 85059127 critical splice donor site probably null
R4620:Usp32 UTSW 11 85059127 critical splice donor site probably null
R4744:Usp32 UTSW 11 84994393 missense probably damaging 1.00
R4909:Usp32 UTSW 11 85055772 nonsense probably null
R5056:Usp32 UTSW 11 85026795 missense probably benign 0.07
R5111:Usp32 UTSW 11 85077331 missense possibly damaging 0.95
R5213:Usp32 UTSW 11 85022259 missense probably damaging 1.00
R5308:Usp32 UTSW 11 85017718 missense probably benign 0.12
R5381:Usp32 UTSW 11 85059127 critical splice donor site probably benign
R5538:Usp32 UTSW 11 85017786 missense possibly damaging 0.65
R5659:Usp32 UTSW 11 85077414 missense possibly damaging 0.94
R6006:Usp32 UTSW 11 84992451 critical splice donor site probably null
R6011:Usp32 UTSW 11 85032097 missense possibly damaging 0.70
R6029:Usp32 UTSW 11 85025582 missense probably damaging 0.99
R6074:Usp32 UTSW 11 84994573 missense probably benign 0.00
R6331:Usp32 UTSW 11 84986576 missense possibly damaging 0.92
R6353:Usp32 UTSW 11 85022281 missense probably benign
R6714:Usp32 UTSW 11 85026870 missense probably damaging 0.99
R6778:Usp32 UTSW 11 85025686 missense probably benign 0.00
R6988:Usp32 UTSW 11 85010143 missense probably benign 0.35
R6992:Usp32 UTSW 11 85032088 missense probably damaging 0.99
R7182:Usp32 UTSW 11 85040170 missense probably benign 0.34
R7198:Usp32 UTSW 11 85022855 frame shift probably null
R7201:Usp32 UTSW 11 85022855 frame shift probably null
X0028:Usp32 UTSW 11 84992606 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GTTGTCAAGAAGAGACCAATTTCC -3'
(R):5'- AAGCTTCATTTTCACTGGCTAC -3'

Sequencing Primer
(F):5'- CCTGGTCTACAAAGTGAGTTCCAG -3'
(R):5'- TCACTTGTAAGCTCATACTAATTGTG -3'
Posted On2019-06-26