Incidental Mutation 'R0590:Plk5'
ID55931
Institutional Source Beutler Lab
Gene Symbol Plk5
Ensembl Gene ENSMUSG00000035486
Gene Namepolo like kinase 5
Synonyms
MMRRC Submission 038780-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.266) question?
Stock #R0590 (G1)
Quality Score155
Status Validated
Chromosome10
Chromosomal Location80356459-80365489 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 80360223 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 238 (R238H)
Ref Sequence ENSEMBL: ENSMUSP00000100988 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039836] [ENSMUST00000105351]
Predicted Effect probably damaging
Transcript: ENSMUST00000039836
AA Change: R242H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044400
Gene: ENSMUSG00000035486
AA Change: R242H

DomainStartEndE-ValueType
low complexity region 4 11 N/A INTRINSIC
S_TKc 27 283 2.41e-90 SMART
Pfam:POLO_box 425 486 4.9e-18 PFAM
low complexity region 583 596 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105351
AA Change: R238H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100988
Gene: ENSMUSG00000035486
AA Change: R238H

DomainStartEndE-ValueType
low complexity region 4 11 N/A INTRINSIC
S_TKc 27 279 2.56e-94 SMART
Pfam:POLO_box 420 483 1.6e-17 PFAM
low complexity region 579 592 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146826
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152544
Meta Mutation Damage Score 0.272 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.7%
  • 20x: 95.7%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acnat2 C T 4: 49,383,273 M93I probably benign Het
Adamts16 T C 13: 70,800,954 D196G probably benign Het
Adhfe1 T A 1: 9,548,153 probably null Het
AI661453 A G 17: 47,467,074 probably benign Het
Apc G T 18: 34,316,230 E2026* probably null Het
Atg2a GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC 19: 6,245,007 probably benign Het
BC017158 A G 7: 128,297,470 L134P probably damaging Het
Cad T C 5: 31,062,231 S688P probably damaging Het
Ccdc191 C T 16: 43,931,341 R345* probably null Het
Dcaf13 T A 15: 39,145,085 probably benign Het
Drc1 A G 5: 30,363,136 D607G probably benign Het
Fam160a1 T C 3: 85,672,376 R841G probably benign Het
Gli1 G T 10: 127,331,563 A607E possibly damaging Het
Gls G A 1: 52,212,375 probably benign Het
Gria1 A T 11: 57,289,409 Q728H probably damaging Het
Hcrtr1 A G 4: 130,135,694 L198P probably damaging Het
Ifngr1 T A 10: 19,603,942 probably benign Het
Ipo5 T C 14: 120,944,357 V954A possibly damaging Het
Kcnh5 G T 12: 74,965,261 A628D probably damaging Het
Kif14 T C 1: 136,482,472 S646P probably damaging Het
Ksr1 A G 11: 79,045,140 S133P probably damaging Het
Neb T C 2: 52,137,290 M7143V probably damaging Het
Nelfa G A 5: 33,901,825 P229S probably damaging Het
Nfatc2 T C 2: 168,571,199 T169A probably damaging Het
Nr1h4 A G 10: 89,456,567 Y398H probably damaging Het
Nrcam A G 12: 44,564,032 E511G probably damaging Het
Ocstamp T A 2: 165,397,751 R172W probably damaging Het
Olfr1130 A G 2: 87,607,994 E202G probably damaging Het
Olfr26 T A 9: 38,855,470 M136K probably damaging Het
Olfr27 T C 9: 39,144,721 V207A probably benign Het
Phf14 G A 6: 11,961,578 V405I possibly damaging Het
Pole A G 5: 110,317,926 E1240G probably benign Het
Prdm15 A G 16: 97,797,761 I899T possibly damaging Het
Psip1 T C 4: 83,458,144 N486S probably benign Het
Rlf A G 4: 121,170,833 probably benign Het
Rttn T C 18: 88,979,635 S255P probably damaging Het
Sema6c A G 3: 95,172,623 K711E probably damaging Het
Slc4a10 A T 2: 62,190,893 probably benign Het
Trim36 T G 18: 46,172,576 S435R probably benign Het
Ucp1 A G 8: 83,291,603 probably benign Het
Vmn1r17 T C 6: 57,361,014 Y122C probably benign Het
Vmn1r23 A G 6: 57,926,364 V143A probably benign Het
Wdfy4 T A 14: 33,041,174 Q2166L probably benign Het
Zc3h7b C T 15: 81,776,998 T346M possibly damaging Het
Zfhx4 T A 3: 5,402,633 V2617D probably damaging Het
Other mutations in Plk5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02136:Plk5 APN 10 80363167 critical splice donor site probably null
IGL02605:Plk5 APN 10 80363062 missense probably damaging 0.99
R0083:Plk5 UTSW 10 80356662 missense possibly damaging 0.91
R0783:Plk5 UTSW 10 80361130 missense probably benign
R1815:Plk5 UTSW 10 80364021 missense probably benign 0.03
R1866:Plk5 UTSW 10 80360569 splice site probably null
R1991:Plk5 UTSW 10 80363102 missense possibly damaging 0.53
R4501:Plk5 UTSW 10 80359471 missense probably benign 0.05
R4580:Plk5 UTSW 10 80360467 missense possibly damaging 0.95
R4731:Plk5 UTSW 10 80358797 missense probably damaging 1.00
R4801:Plk5 UTSW 10 80359304 missense possibly damaging 0.87
R4802:Plk5 UTSW 10 80359304 missense possibly damaging 0.87
R5084:Plk5 UTSW 10 80358889 missense possibly damaging 0.75
R5346:Plk5 UTSW 10 80363108 missense probably damaging 1.00
R5702:Plk5 UTSW 10 80360567 critical splice donor site probably null
R6417:Plk5 UTSW 10 80364072 missense probably benign 0.07
R6548:Plk5 UTSW 10 80363045 missense probably damaging 1.00
R6695:Plk5 UTSW 10 80360201 missense probably benign 0.22
X0019:Plk5 UTSW 10 80364301 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCTGCGTTTCGCCATGTGTATC -3'
(R):5'- TGAATTACTCGCCTCGTTGCCG -3'

Sequencing Primer
(F):5'- CGCCATGTGTATCAAGAAAACTG -3'
(R):5'- CCTCTTTTGAGGTAAAGGGACC -3'
Posted On2013-07-11