Incidental Mutation 'R7188:Slc12a6'
ID559406
Institutional Source Beutler Lab
Gene Symbol Slc12a6
Ensembl Gene ENSMUSG00000027130
Gene Namesolute carrier family 12, member 6
Synonymsgaxp, KCC3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.177) question?
Stock #R7188 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location112265825-112363163 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 112334415 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 153 (M153T)
Ref Sequence ENSEMBL: ENSMUSP00000028549 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028549] [ENSMUST00000053666] [ENSMUST00000110987] [ENSMUST00000110991] [ENSMUST00000141047]
Predicted Effect probably benign
Transcript: ENSMUST00000028549
AA Change: M153T

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000028549
Gene: ENSMUSG00000027130
AA Change: M153T

DomainStartEndE-ValueType
low complexity region 28 53 N/A INTRINSIC
SCOP:d1qqea_ 114 171 8e-3 SMART
Pfam:AA_permease 190 384 4.1e-25 PFAM
Pfam:AA_permease 453 761 2.3e-43 PFAM
Pfam:SLC12 773 897 7.1e-20 PFAM
Pfam:SLC12 892 1150 3.9e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000053666
AA Change: M102T

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000051490
Gene: ENSMUSG00000027130
AA Change: M102T

DomainStartEndE-ValueType
Pfam:AA_permease 139 333 2.3e-25 PFAM
Pfam:AA_permease_2 385 668 1.5e-19 PFAM
Pfam:AA_permease 391 710 4.5e-41 PFAM
low complexity region 828 842 N/A INTRINSIC
Pfam:KCl_Cotrans_1 967 996 2.2e-23 PFAM
low complexity region 1079 1091 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110987
AA Change: M138T

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000106615
Gene: ENSMUSG00000027130
AA Change: M138T

DomainStartEndE-ValueType
low complexity region 28 53 N/A INTRINSIC
SCOP:d1qqea_ 99 156 4e-3 SMART
Pfam:AA_permease 175 369 3.9e-25 PFAM
Pfam:AA_permease_2 421 704 3.2e-19 PFAM
Pfam:AA_permease 426 746 5.8e-41 PFAM
low complexity region 864 878 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110991
AA Change: M153T

PolyPhen 2 Score 0.273 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000106619
Gene: ENSMUSG00000027130
AA Change: M153T

DomainStartEndE-ValueType
low complexity region 28 53 N/A INTRINSIC
SCOP:d1qqea_ 114 171 7e-3 SMART
Pfam:AA_permease 190 384 4.2e-25 PFAM
Pfam:AA_permease_2 436 719 2.9e-19 PFAM
Pfam:AA_permease 442 761 8.2e-41 PFAM
low complexity region 879 893 N/A INTRINSIC
Pfam:KCl_Cotrans_1 1018 1047 2.7e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141047
AA Change: M138T

PolyPhen 2 Score 0.157 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000124314
Gene: ENSMUSG00000096764
AA Change: M138T

DomainStartEndE-ValueType
low complexity region 28 53 N/A INTRINSIC
SCOP:d1qqea_ 99 156 8e-3 SMART
Pfam:AA_permease 175 369 6.6e-25 PFAM
Pfam:AA_permease 438 746 3.6e-43 PFAM
Pfam:SLC12 758 884 6.8e-20 PFAM
Pfam:SLC12 877 1033 5.9e-20 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the K-Cl cotransporter (KCC) family. K-Cl cotransporters are integral membrane proteins that lower intracellular chloride concentrations below the electrochemical equilibrium potential. The proteins encoded by this gene are activated by cell swelling induced by hypotonic conditions. Alternate splicing results in multiple transcript variants encoding different isoforms. Mutations in this gene are associated with agenesis of the corpus callosum with peripheral neuropathy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit locomotor deficits, progressive neurodegeneration, slow progressive deafness and failure to breed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A T 3: 36,950,013 T1624S probably benign Het
Abca17 T C 17: 24,335,626 Y118C possibly damaging Het
Abcb6 A G 1: 75,174,137 probably null Het
Acox2 T A 14: 8,252,996 I236L possibly damaging Het
Adamts12 A T 15: 11,336,325 K1499* probably null Het
Ankrd24 G T 10: 81,636,390 E20* probably null Het
Arsa A T 15: 89,475,627 Y32* probably null Het
Atp9b A G 18: 80,917,826 S57P Het
Atr G T 9: 95,862,791 E54* probably null Het
Bace1 A G 9: 45,856,095 D192G probably benign Het
Cacna1d T C 14: 30,089,833 S1309G probably benign Het
Cd177 G T 7: 24,756,647 T232K probably damaging Het
Chil4 T A 3: 106,204,159 D213V probably damaging Het
Cmya5 A T 13: 93,046,038 I3538N probably damaging Het
Cyp26a1 T A 19: 37,699,305 M287K possibly damaging Het
Dcaf5 T C 12: 80,399,958 D129G probably damaging Het
Dnah12 A C 14: 26,814,413 K2095N probably benign Het
Dnpep G A 1: 75,316,057 S106L probably damaging Het
Dock2 C T 11: 34,239,675 E1499K possibly damaging Het
Dus4l A G 12: 31,646,715 F88L probably damaging Het
Fcrls A C 3: 87,259,523 D54E probably benign Het
Fign T A 2: 63,979,606 H440L possibly damaging Het
Gabpa A G 16: 84,846,286 D157G probably damaging Het
Gapdh T A 6: 125,165,440 probably benign Het
Gbp8 G T 5: 105,016,215 R406S probably benign Het
Gm15922 A T 7: 3,738,829 V184E probably damaging Het
Gm21775 A G Y: 10,553,894 R148G possibly damaging Het
Gm28363 G A 1: 117,698,849 V6I unknown Het
Gmps A G 3: 64,011,561 D522G probably damaging Het
Gpr75 T C 11: 30,892,687 S531P probably damaging Het
Hars2 G T 18: 36,790,561 E468D probably benign Het
Jph4 C A 14: 55,115,207 R23L probably damaging Het
Kctd12 T A 14: 102,981,794 Y216F probably benign Het
L3mbtl1 G A 2: 162,949,540 probably null Het
Lama4 G A 10: 38,965,733 probably benign Het
Lyst T A 13: 13,752,090 S3494T possibly damaging Het
Mybpc2 A G 7: 44,506,193 S879P probably benign Het
Ncaph C T 2: 127,122,114 V304M probably benign Het
Noto A T 6: 85,428,065 I229F possibly damaging Het
Olfr1061 T A 2: 86,413,351 K234* probably null Het
Olfr1209 T C 2: 88,909,859 D178G probably damaging Het
Olfr964-ps1 T C 9: 39,686,435 M170V unknown Het
Pald1 A T 10: 61,347,066 V368E probably damaging Het
Pde9a T A 17: 31,459,097 M217K probably damaging Het
Pitpnm2 G T 5: 124,121,303 A1323E probably benign Het
Ppp1r32 T A 19: 10,482,338 M2L probably benign Het
Ppp1r3a T C 6: 14,719,191 S575G probably benign Het
Prok1 T C 3: 107,239,625 I9V probably benign Het
Ptprc A T 1: 138,071,180 V905D probably damaging Het
Rbm25 G T 12: 83,663,998 G295V unknown Het
Rreb1 T C 13: 37,916,568 M225T possibly damaging Het
Ryr3 T C 2: 113,028,644 K55E probably damaging Het
Scgb2b26 G T 7: 33,944,954 T4K probably damaging Het
Setx C A 2: 29,148,172 D1556E probably benign Het
Sft2d1 C T 17: 8,323,332 T136I possibly damaging Het
Sirt5 C T 13: 43,371,904 A63V possibly damaging Het
Skor2 A G 18: 76,859,809 T409A possibly damaging Het
Slc17a2 A G 13: 23,822,365 Y458C probably damaging Het
Slc36a2 A G 11: 55,162,657 V385A possibly damaging Het
St6galnac5 A T 3: 152,846,494 H145Q probably damaging Het
Tal1 T A 4: 115,068,413 N226K probably damaging Het
Tgtp2 G C 11: 49,059,308 R146G probably damaging Het
Uhrf1bp1l T C 10: 89,779,882 V129A probably damaging Het
Usp6nl T C 2: 6,440,519 S436P probably benign Het
Utp3 A G 5: 88,554,762 E50G probably benign Het
Zfp12 A T 5: 143,239,994 Q19L probably damaging Het
Other mutations in Slc12a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01488:Slc12a6 APN 2 112353064 splice site probably null
IGL02573:Slc12a6 APN 2 112358641 critical splice donor site probably null
R0548:Slc12a6 UTSW 2 112335924 critical splice donor site probably null
R1495:Slc12a6 UTSW 2 112354190 missense probably damaging 0.99
R1726:Slc12a6 UTSW 2 112347426 missense probably damaging 1.00
R1856:Slc12a6 UTSW 2 112335927 splice site probably null
R1958:Slc12a6 UTSW 2 112355158 missense possibly damaging 0.92
R2112:Slc12a6 UTSW 2 112356485 missense probably damaging 1.00
R2865:Slc12a6 UTSW 2 112347317 missense probably benign 0.09
R3888:Slc12a6 UTSW 2 112267030 missense possibly damaging 0.76
R4412:Slc12a6 UTSW 2 112335888 missense possibly damaging 0.95
R4655:Slc12a6 UTSW 2 112357766 critical splice acceptor site probably null
R4669:Slc12a6 UTSW 2 112354295 missense probably damaging 1.00
R4928:Slc12a6 UTSW 2 112352961 missense probably damaging 1.00
R4974:Slc12a6 UTSW 2 112358525 missense probably damaging 1.00
R5016:Slc12a6 UTSW 2 112356627 intron probably benign
R5372:Slc12a6 UTSW 2 112347360 nonsense probably null
R5405:Slc12a6 UTSW 2 112339379 missense probably damaging 1.00
R5786:Slc12a6 UTSW 2 112284722 missense probably benign 0.01
R5836:Slc12a6 UTSW 2 112341998 missense possibly damaging 0.62
R6280:Slc12a6 UTSW 2 112337358 missense probably damaging 1.00
R6310:Slc12a6 UTSW 2 112335839 missense probably damaging 1.00
R6525:Slc12a6 UTSW 2 112352451 missense probably damaging 1.00
R6597:Slc12a6 UTSW 2 112352935 missense probably damaging 1.00
R6723:Slc12a6 UTSW 2 112337942 missense probably damaging 1.00
R6895:Slc12a6 UTSW 2 112355095 missense probably damaging 1.00
R7059:Slc12a6 UTSW 2 112352912 missense probably damaging 0.99
R7395:Slc12a6 UTSW 2 112352542 missense probably damaging 1.00
R7552:Slc12a6 UTSW 2 112341974 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCACACAGTCTTTCAAATGTGAG -3'
(R):5'- GCTCAGCATTGTCTGGGTAC -3'

Sequencing Primer
(F):5'- CCTGGTAAAGTATTTTGTTGCT -3'
(R):5'- CTCAGCATTGTCTGGGTACATAAAAC -3'
Posted On2019-06-26