Incidental Mutation 'R7188:Pald1'
ID559432
Institutional Source Beutler Lab
Gene Symbol Pald1
Ensembl Gene ENSMUSG00000020092
Gene Namephosphatase domain containing, paladin 1
Synonymspaladin, X99384
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.130) question?
Stock #R7188 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location61319656-61383530 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 61347066 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 368 (V368E)
Ref Sequence ENSEMBL: ENSMUSP00000020289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020289]
Predicted Effect probably damaging
Transcript: ENSMUST00000020289
AA Change: V368E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000020289
Gene: ENSMUSG00000020092
AA Change: V368E

DomainStartEndE-ValueType
low complexity region 2 37 N/A INTRINSIC
PTPlike_phytase 164 333 4.33e-53 SMART
low complexity region 428 441 N/A INTRINSIC
PTPlike_phytase 548 682 5.37e-49 SMART
low complexity region 757 768 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A T 3: 36,950,013 T1624S probably benign Het
Abca17 T C 17: 24,335,626 Y118C possibly damaging Het
Abcb6 A G 1: 75,174,137 probably null Het
Acox2 T A 14: 8,252,996 I236L possibly damaging Het
Adamts12 A T 15: 11,336,325 K1499* probably null Het
Ankrd24 G T 10: 81,636,390 E20* probably null Het
Arsa A T 15: 89,475,627 Y32* probably null Het
Atp9b A G 18: 80,917,826 S57P Het
Atr G T 9: 95,862,791 E54* probably null Het
Bace1 A G 9: 45,856,095 D192G probably benign Het
Cacna1d T C 14: 30,089,833 S1309G probably benign Het
Cd177 G T 7: 24,756,647 T232K probably damaging Het
Chil4 T A 3: 106,204,159 D213V probably damaging Het
Cmya5 A T 13: 93,046,038 I3538N probably damaging Het
Cyp26a1 T A 19: 37,699,305 M287K possibly damaging Het
Dcaf5 T C 12: 80,399,958 D129G probably damaging Het
Dnah12 A C 14: 26,814,413 K2095N probably benign Het
Dnpep G A 1: 75,316,057 S106L probably damaging Het
Dock2 C T 11: 34,239,675 E1499K possibly damaging Het
Dus4l A G 12: 31,646,715 F88L probably damaging Het
Fcrls A C 3: 87,259,523 D54E probably benign Het
Fign T A 2: 63,979,606 H440L possibly damaging Het
Gabpa A G 16: 84,846,286 D157G probably damaging Het
Gapdh T A 6: 125,165,440 probably benign Het
Gbp8 G T 5: 105,016,215 R406S probably benign Het
Gm15922 A T 7: 3,738,829 V184E probably damaging Het
Gm21775 A G Y: 10,553,894 R148G possibly damaging Het
Gm28363 G A 1: 117,698,849 V6I unknown Het
Gmps A G 3: 64,011,561 D522G probably damaging Het
Gpr75 T C 11: 30,892,687 S531P probably damaging Het
Hars2 G T 18: 36,790,561 E468D probably benign Het
Jph4 C A 14: 55,115,207 R23L probably damaging Het
Kctd12 T A 14: 102,981,794 Y216F probably benign Het
L3mbtl1 G A 2: 162,949,540 probably null Het
Lama4 G A 10: 38,965,733 probably benign Het
Lyst T A 13: 13,752,090 S3494T possibly damaging Het
Mybpc2 A G 7: 44,506,193 S879P probably benign Het
Ncaph C T 2: 127,122,114 V304M probably benign Het
Noto A T 6: 85,428,065 I229F possibly damaging Het
Olfr1061 T A 2: 86,413,351 K234* probably null Het
Olfr1209 T C 2: 88,909,859 D178G probably damaging Het
Olfr964-ps1 T C 9: 39,686,435 M170V unknown Het
Pde9a T A 17: 31,459,097 M217K probably damaging Het
Pitpnm2 G T 5: 124,121,303 A1323E probably benign Het
Ppp1r32 T A 19: 10,482,338 M2L probably benign Het
Ppp1r3a T C 6: 14,719,191 S575G probably benign Het
Prok1 T C 3: 107,239,625 I9V probably benign Het
Ptprc A T 1: 138,071,180 V905D probably damaging Het
Rbm25 G T 12: 83,663,998 G295V unknown Het
Rreb1 T C 13: 37,916,568 M225T possibly damaging Het
Ryr3 T C 2: 113,028,644 K55E probably damaging Het
Scgb2b26 G T 7: 33,944,954 T4K probably damaging Het
Setx C A 2: 29,148,172 D1556E probably benign Het
Sft2d1 C T 17: 8,323,332 T136I possibly damaging Het
Sirt5 C T 13: 43,371,904 A63V possibly damaging Het
Skor2 A G 18: 76,859,809 T409A possibly damaging Het
Slc12a6 T C 2: 112,334,415 M153T probably benign Het
Slc17a2 A G 13: 23,822,365 Y458C probably damaging Het
Slc36a2 A G 11: 55,162,657 V385A possibly damaging Het
St6galnac5 A T 3: 152,846,494 H145Q probably damaging Het
Tal1 T A 4: 115,068,413 N226K probably damaging Het
Tgtp2 G C 11: 49,059,308 R146G probably damaging Het
Uhrf1bp1l T C 10: 89,779,882 V129A probably damaging Het
Usp6nl T C 2: 6,440,519 S436P probably benign Het
Utp3 A G 5: 88,554,762 E50G probably benign Het
Zfp12 A T 5: 143,239,994 Q19L probably damaging Het
Other mutations in Pald1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02183:Pald1 APN 10 61347141 splice site probably benign
IGL03068:Pald1 APN 10 61321184 missense possibly damaging 0.94
IGL03106:Pald1 APN 10 61347105 missense probably benign 0.41
R0331:Pald1 UTSW 10 61340929 critical splice donor site probably null
R0497:Pald1 UTSW 10 61341315 missense probably damaging 0.99
R1181:Pald1 UTSW 10 61347587 splice site probably benign
R1437:Pald1 UTSW 10 61341285 missense possibly damaging 0.63
R1466:Pald1 UTSW 10 61348525 splice site probably benign
R1827:Pald1 UTSW 10 61355922 small deletion probably benign
R2129:Pald1 UTSW 10 61348306 critical splice donor site probably null
R2184:Pald1 UTSW 10 61347136 missense possibly damaging 0.46
R2260:Pald1 UTSW 10 61352971 missense probably damaging 1.00
R3051:Pald1 UTSW 10 61346763 nonsense probably null
R3690:Pald1 UTSW 10 61355808 splice site probably null
R3713:Pald1 UTSW 10 61342365 missense possibly damaging 0.67
R3876:Pald1 UTSW 10 61347487 missense probably damaging 0.97
R4261:Pald1 UTSW 10 61343692 missense probably damaging 1.00
R4600:Pald1 UTSW 10 61348616 missense probably benign 0.00
R4603:Pald1 UTSW 10 61348616 missense probably benign 0.00
R5069:Pald1 UTSW 10 61341246 missense possibly damaging 0.50
R5354:Pald1 UTSW 10 61348661 missense probably damaging 1.00
R5590:Pald1 UTSW 10 61343710 missense probably damaging 1.00
R5705:Pald1 UTSW 10 61323297 missense possibly damaging 0.90
R5780:Pald1 UTSW 10 61339218 missense probably damaging 1.00
R6239:Pald1 UTSW 10 61321131 missense possibly damaging 0.59
R6380:Pald1 UTSW 10 61350935 missense possibly damaging 0.86
R6812:Pald1 UTSW 10 61342922 missense possibly damaging 0.53
R6891:Pald1 UTSW 10 61348532 critical splice donor site probably null
R6949:Pald1 UTSW 10 61321217 missense probably benign 0.23
R7038:Pald1 UTSW 10 61339299 missense probably benign
R7051:Pald1 UTSW 10 61323346 missense probably benign 0.26
R7339:Pald1 UTSW 10 61323331 missense possibly damaging 0.60
Predicted Primers PCR Primer
(F):5'- CCTTCAGGTCATGCAACTCTG -3'
(R):5'- TCCCCAGTAGAATTCAGAAGTG -3'

Sequencing Primer
(F):5'- ATCGCTCGATCCACCTAGG -3'
(R):5'- CAGAAGTGATTTGATGCCTCCCAG -3'
Posted On2019-06-26