Incidental Mutation 'R7189:Olfr665'
ID559495
Institutional Source Beutler Lab
Gene Symbol Olfr665
Ensembl Gene ENSMUSG00000073917
Gene Nameolfactory receptor 665
SynonymsGA_x6K02T2PBJ9-7509539-7510489, MOR34-7
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R7189 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location104878031-104882906 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 104881141 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 145 (K145*)
Ref Sequence ENSEMBL: ENSMUSP00000150603 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098165] [ENSMUST00000215761] [ENSMUST00000216257] [ENSMUST00000216971]
Predicted Effect probably null
Transcript: ENSMUST00000098165
AA Change: K145*
SMART Domains Protein: ENSMUSP00000095768
Gene: ENSMUSG00000073917
AA Change: K145*

DomainStartEndE-ValueType
Pfam:7tm_4 33 313 6.4e-105 PFAM
Pfam:7TM_GPCR_Srsx 37 310 1e-5 PFAM
Pfam:7tm_1 43 295 1.4e-17 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000215761
AA Change: K145*
Predicted Effect probably null
Transcript: ENSMUST00000216257
AA Change: K145*
Predicted Effect probably null
Transcript: ENSMUST00000216971
AA Change: K145*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 95% (57/60)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 G T 2: 103,567,516 A264S probably benign Het
Atr G T 9: 95,862,791 E54* probably null Het
Bmp4 A G 14: 46,383,999 S363P probably damaging Het
Cfap54 C A 10: 92,937,728 A2077S unknown Het
Chrna7 T C 7: 63,106,027 D257G probably damaging Het
Chrnd C T 1: 87,191,058 R46W probably damaging Het
Cntn2 A G 1: 132,517,086 I851T probably damaging Het
Col3a1 T A 1: 45,333,657 I534K unknown Het
Cyp3a25 A T 5: 146,003,060 L46I probably benign Het
Dnah7b G C 1: 46,242,142 G2788R probably damaging Het
Dnpep T C 1: 75,313,430 E301G probably damaging Het
Efcab3 T C 11: 105,095,864 S30P probably benign Het
Elk4 A G 1: 132,019,389 I373V probably damaging Het
Fam161b T C 12: 84,348,646 S508G probably damaging Het
Fam198b T A 3: 79,886,807 L194* probably null Het
Fam214a T C 9: 75,004,351 C42R probably damaging Het
Fam71d C T 12: 78,712,208 P101S probably benign Het
Fgf10 A G 13: 118,789,123 E146G probably benign Het
Fsip2 A G 2: 82,993,237 D6438G possibly damaging Het
Gm3139 T A 5: 94,537,751 Y423* probably null Het
Gm49355 T A 14: 12,296,672 C10* probably null Het
Hfm1 A G 5: 106,901,703 probably null Het
Hivep3 T C 4: 120,132,219 S1956P probably damaging Het
Hrh2 A G 13: 54,221,251 S369G unknown Het
Hspg2 T C 4: 137,533,561 probably null Het
Hsph1 T C 5: 149,630,460 Y181C probably damaging Het
Kcnh8 A G 17: 52,894,117 probably null Het
Kctd1 C T 18: 15,062,643 E308K possibly damaging Het
Kdm8 A T 7: 125,460,931 Y335F probably damaging Het
Kif2b C G 11: 91,577,137 G107R probably benign Het
Lama4 G A 10: 38,965,733 probably benign Het
Lepr T C 4: 101,814,764 V995A probably benign Het
Mfsd4a A T 1: 132,052,393 V375E probably damaging Het
Mgl2 G T 11: 70,137,043 W359L probably damaging Het
Muc5b C A 7: 141,861,061 Y2581* probably null Het
Nol10 G T 12: 17,373,561 probably null Het
Olfr1297 T A 2: 111,621,193 M294L probably benign Het
Otud3 C T 4: 138,909,554 V99M probably damaging Het
Parvb T C 15: 84,303,471 probably null Het
Pclo C A 5: 14,521,918 P439Q possibly damaging Het
Peg10 CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC CATC 6: 4,756,431 probably benign Het
Pkn1 A T 8: 83,692,673 H100Q possibly damaging Het
Plce1 A T 19: 38,760,137 I1771F probably damaging Het
Plxna2 G T 1: 194,801,058 R1559L possibly damaging Het
Ppp2r3a T A 9: 101,126,422 I416L possibly damaging Het
Robo1 C A 16: 72,960,151 C333* probably null Het
Ryr2 A T 13: 11,883,123 Y129N probably damaging Het
Schip1 A T 3: 68,617,699 K359M probably damaging Het
Schip1 G T 3: 68,617,700 K359N probably damaging Het
Sh2d2a T A 3: 87,848,361 S65T possibly damaging Het
Ssrp1 G A 2: 85,045,562 M588I probably benign Het
Stim2 T A 5: 54,116,128 C567S probably benign Het
Syne1 C A 10: 5,424,295 A171S probably benign Het
Tigd3 A G 19: 5,893,022 S27P probably benign Het
Vipr1 C A 9: 121,664,554 Q224K probably damaging Het
Vmn1r75 T A 7: 11,880,548 M69K possibly damaging Het
Vmn2r72 T G 7: 85,754,917 D22A probably benign Het
Zbtb24 G A 10: 41,464,476 V523I probably benign Het
Zbtb43 A G 2: 33,462,295 F20S probably benign Het
Other mutations in Olfr665
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Olfr665 APN 7 104881517 missense probably benign 0.01
IGL01408:Olfr665 APN 7 104880830 missense probably benign 0.02
IGL02022:Olfr665 APN 7 104880934 missense probably damaging 1.00
R0349:Olfr665 UTSW 7 104880992 missense possibly damaging 0.48
R0585:Olfr665 UTSW 7 104881499 missense probably damaging 1.00
R1518:Olfr665 UTSW 7 104881308 nonsense probably null
R1659:Olfr665 UTSW 7 104881180 missense probably benign 0.00
R1727:Olfr665 UTSW 7 104881514 missense probably benign 0.11
R1762:Olfr665 UTSW 7 104881240 missense probably damaging 0.99
R4052:Olfr665 UTSW 7 104881603 missense probably damaging 0.99
R4208:Olfr665 UTSW 7 104881603 missense probably damaging 0.99
R5486:Olfr665 UTSW 7 104880961 missense probably benign 0.02
R5513:Olfr665 UTSW 7 104881499 missense probably damaging 1.00
R6148:Olfr665 UTSW 7 104881082 missense possibly damaging 0.84
R6593:Olfr665 UTSW 7 104881433 missense probably damaging 1.00
R7143:Olfr665 UTSW 7 104881186 missense probably damaging 1.00
R7413:Olfr665 UTSW 7 104880850 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- CATCTTTTGGTTCAGTGTCAAGGAG -3'
(R):5'- GAGCATCTGCCGAAGATAGC -3'

Sequencing Primer
(F):5'- AGGAGATTGATTTCAATGCCTGCC -3'
(R):5'- CACAGCATGGATAATCATGGC -3'
Posted On2019-06-26