Incidental Mutation 'R7189:Fam214a'
ID559499
Institutional Source Beutler Lab
Gene Symbol Fam214a
Ensembl Gene ENSMUSG00000034858
Gene Namefamily with sequence similarity 214, member A
SynonymsBC031353, C130047D21Rik, 6330415I01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.360) question?
Stock #R7189 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location74952884-75032468 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75004351 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 42 (C42R)
Ref Sequence ENSEMBL: ENSMUSP00000080442 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081746] [ENSMUST00000170846] [ENSMUST00000214755] [ENSMUST00000215370]
Predicted Effect probably damaging
Transcript: ENSMUST00000081746
AA Change: C42R

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000080442
Gene: ENSMUSG00000034858
AA Change: C42R

DomainStartEndE-ValueType
low complexity region 349 360 N/A INTRINSIC
internal_repeat_1 361 458 7.22e-14 PROSPERO
internal_repeat_1 473 570 7.22e-14 PROSPERO
low complexity region 840 859 N/A INTRINSIC
DUF4210 885 943 8.5e-29 SMART
Pfam:Chromosome_seg 1024 1081 3.5e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000170846
AA Change: C35R

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000129319
Gene: ENSMUSG00000034858
AA Change: C35R

DomainStartEndE-ValueType
low complexity region 342 353 N/A INTRINSIC
internal_repeat_1 354 451 8.38e-14 PROSPERO
internal_repeat_1 466 563 8.38e-14 PROSPERO
low complexity region 833 852 N/A INTRINSIC
DUF4210 878 936 8.5e-29 SMART
Pfam:Chromosome_seg 1016 1074 1.8e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214755
AA Change: C35R

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect possibly damaging
Transcript: ENSMUST00000215370
AA Change: C35R

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 95% (57/60)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 G T 2: 103,567,516 A264S probably benign Het
Atr G T 9: 95,862,791 E54* probably null Het
Bmp4 A G 14: 46,383,999 S363P probably damaging Het
Cfap54 C A 10: 92,937,728 A2077S unknown Het
Chrna7 T C 7: 63,106,027 D257G probably damaging Het
Chrnd C T 1: 87,191,058 R46W probably damaging Het
Cntn2 A G 1: 132,517,086 I851T probably damaging Het
Col3a1 T A 1: 45,333,657 I534K unknown Het
Cyp3a25 A T 5: 146,003,060 L46I probably benign Het
Dnah7b G C 1: 46,242,142 G2788R probably damaging Het
Dnpep T C 1: 75,313,430 E301G probably damaging Het
Efcab3 T C 11: 105,095,864 S30P probably benign Het
Elk4 A G 1: 132,019,389 I373V probably damaging Het
Fam161b T C 12: 84,348,646 S508G probably damaging Het
Fam198b T A 3: 79,886,807 L194* probably null Het
Fam71d C T 12: 78,712,208 P101S probably benign Het
Fgf10 A G 13: 118,789,123 E146G probably benign Het
Fsip2 A G 2: 82,993,237 D6438G possibly damaging Het
Gm3139 T A 5: 94,537,751 Y423* probably null Het
Gm49355 T A 14: 12,296,672 C10* probably null Het
Hfm1 A G 5: 106,901,703 probably null Het
Hivep3 T C 4: 120,132,219 S1956P probably damaging Het
Hrh2 A G 13: 54,221,251 S369G unknown Het
Hspg2 T C 4: 137,533,561 probably null Het
Hsph1 T C 5: 149,630,460 Y181C probably damaging Het
Kcnh8 A G 17: 52,894,117 probably null Het
Kctd1 C T 18: 15,062,643 E308K possibly damaging Het
Kdm8 A T 7: 125,460,931 Y335F probably damaging Het
Kif2b C G 11: 91,577,137 G107R probably benign Het
Lama4 G A 10: 38,965,733 probably benign Het
Lepr T C 4: 101,814,764 V995A probably benign Het
Mfsd4a A T 1: 132,052,393 V375E probably damaging Het
Mgl2 G T 11: 70,137,043 W359L probably damaging Het
Muc5b C A 7: 141,861,061 Y2581* probably null Het
Nol10 G T 12: 17,373,561 probably null Het
Olfr1297 T A 2: 111,621,193 M294L probably benign Het
Olfr665 A T 7: 104,881,141 K145* probably null Het
Otud3 C T 4: 138,909,554 V99M probably damaging Het
Parvb T C 15: 84,303,471 probably null Het
Pclo C A 5: 14,521,918 P439Q possibly damaging Het
Peg10 CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC CATC 6: 4,756,431 probably benign Het
Pkn1 A T 8: 83,692,673 H100Q possibly damaging Het
Plce1 A T 19: 38,760,137 I1771F probably damaging Het
Plxna2 G T 1: 194,801,058 R1559L possibly damaging Het
Ppp2r3a T A 9: 101,126,422 I416L possibly damaging Het
Robo1 C A 16: 72,960,151 C333* probably null Het
Ryr2 A T 13: 11,883,123 Y129N probably damaging Het
Schip1 A T 3: 68,617,699 K359M probably damaging Het
Schip1 G T 3: 68,617,700 K359N probably damaging Het
Sh2d2a T A 3: 87,848,361 S65T possibly damaging Het
Ssrp1 G A 2: 85,045,562 M588I probably benign Het
Stim2 T A 5: 54,116,128 C567S probably benign Het
Syne1 C A 10: 5,424,295 A171S probably benign Het
Tigd3 A G 19: 5,893,022 S27P probably benign Het
Vipr1 C A 9: 121,664,554 Q224K probably damaging Het
Vmn1r75 T A 7: 11,880,548 M69K possibly damaging Het
Vmn2r72 T G 7: 85,754,917 D22A probably benign Het
Zbtb24 G A 10: 41,464,476 V523I probably benign Het
Zbtb43 A G 2: 33,462,295 F20S probably benign Het
Other mutations in Fam214a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Fam214a APN 9 75025790 missense probably benign 0.28
IGL00588:Fam214a APN 9 75009581 missense probably damaging 1.00
IGL01887:Fam214a APN 9 75017057 missense probably benign 0.39
IGL02828:Fam214a APN 9 75006432 missense probably damaging 1.00
IGL03060:Fam214a APN 9 75010168 missense probably damaging 0.96
IGL03277:Fam214a APN 9 75009232 missense probably damaging 1.00
R0052:Fam214a UTSW 9 75018983 splice site probably benign
R0052:Fam214a UTSW 9 75018983 splice site probably benign
R0615:Fam214a UTSW 9 75004288 missense probably damaging 1.00
R0723:Fam214a UTSW 9 75009451 missense probably damaging 1.00
R1428:Fam214a UTSW 9 75006321 missense probably benign 0.07
R1448:Fam214a UTSW 9 75010174 nonsense probably null
R1656:Fam214a UTSW 9 75008959 missense probably benign 0.00
R2024:Fam214a UTSW 9 75010390 missense probably damaging 0.98
R3147:Fam214a UTSW 9 75008838 missense probably benign 0.25
R3745:Fam214a UTSW 9 75009862 missense probably benign 0.00
R4105:Fam214a UTSW 9 75008776 missense probably damaging 1.00
R4224:Fam214a UTSW 9 75008726 missense probably damaging 1.00
R4496:Fam214a UTSW 9 75031531 missense probably damaging 0.99
R4519:Fam214a UTSW 9 75023647 missense probably damaging 1.00
R4715:Fam214a UTSW 9 75012968 missense probably damaging 1.00
R4885:Fam214a UTSW 9 75006367 missense probably damaging 1.00
R5009:Fam214a UTSW 9 75008889 missense probably damaging 0.98
R5574:Fam214a UTSW 9 75010390 missense probably damaging 1.00
R5645:Fam214a UTSW 9 75025679 missense probably damaging 1.00
R5696:Fam214a UTSW 9 75010117 missense probably benign 0.01
R5891:Fam214a UTSW 9 75004386 missense probably damaging 1.00
R5936:Fam214a UTSW 9 75009304 missense probably benign 0.00
R6165:Fam214a UTSW 9 75025672 missense probably damaging 0.96
R6228:Fam214a UTSW 9 75006363 missense possibly damaging 0.94
R6419:Fam214a UTSW 9 75009337 missense probably benign 0.20
R6499:Fam214a UTSW 9 75023648 missense probably damaging 1.00
R6631:Fam214a UTSW 9 74953825 missense possibly damaging 0.71
R6649:Fam214a UTSW 9 75010150 missense probably damaging 0.96
R6849:Fam214a UTSW 9 75009312 missense probably damaging 0.96
R7402:Fam214a UTSW 9 75006386 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCTCAGTGAGTAGATAGGAATGGTG -3'
(R):5'- CAACATCGCCTCAGCTTAGG -3'

Sequencing Primer
(F):5'- CAGCCCGGGTTGTATGAAAC -3'
(R):5'- TCAGCTTAGGGAGTCACCTG -3'
Posted On2019-06-26