Incidental Mutation 'R7189:Atr'
ID559500
Institutional Source Beutler Lab
Gene Symbol Atr
Ensembl Gene ENSMUSG00000032409
Gene Nameataxia telangiectasia and Rad3 related
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7189 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location95857597-95951781 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 95862791 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 54 (E54*)
Ref Sequence ENSEMBL: ENSMUSP00000149953 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034980] [ENSMUST00000215311]
Predicted Effect probably null
Transcript: ENSMUST00000034980
AA Change: E54*
SMART Domains Protein: ENSMUSP00000034980
Gene: ENSMUSG00000032409
AA Change: E54*

DomainStartEndE-ValueType
low complexity region 431 449 N/A INTRINSIC
low complexity region 889 897 N/A INTRINSIC
low complexity region 998 1013 N/A INTRINSIC
UME 1119 1225 2.3e-43 SMART
low complexity region 1352 1362 N/A INTRINSIC
Pfam:FAT 1771 2092 9.2e-51 PFAM
PI3Kc 2320 2630 7.51e-124 SMART
FATC 2609 2641 6.22e-13 SMART
Predicted Effect probably null
Transcript: ENSMUST00000215311
AA Change: E54*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 95% (57/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs the PI3/PI4-kinase family, and is most closely related to ATM, a protein kinase encoded by the gene mutated in ataxia telangiectasia. This protein and ATM share similarity with Schizosaccharomyces pombe rad3, a cell cycle checkpoint gene required for cell cycle arrest and DNA damage repair in response to DNA damage. This kinase has been shown to phosphorylate checkpoint kinase CHK1, checkpoint proteins RAD17, and RAD9, as well as tumor suppressor protein BRCA1. Mutations of this gene are associated with Seckel syndrome. An alternatively spliced transcript variant of this gene has been reported, however, its full length nature is not known. Transcript variants utilizing alternative polyA sites exist. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality. Mice heterozygous for a knock-out allele exhibit premature death and increased tumor incidence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 G T 2: 103,567,516 A264S probably benign Het
Bmp4 A G 14: 46,383,999 S363P probably damaging Het
Cfap54 C A 10: 92,937,728 A2077S unknown Het
Chrna7 T C 7: 63,106,027 D257G probably damaging Het
Chrnd C T 1: 87,191,058 R46W probably damaging Het
Cntn2 A G 1: 132,517,086 I851T probably damaging Het
Col3a1 T A 1: 45,333,657 I534K unknown Het
Cyp3a25 A T 5: 146,003,060 L46I probably benign Het
Dnah7b G C 1: 46,242,142 G2788R probably damaging Het
Dnpep T C 1: 75,313,430 E301G probably damaging Het
Efcab3 T C 11: 105,095,864 S30P probably benign Het
Elk4 A G 1: 132,019,389 I373V probably damaging Het
Fam161b T C 12: 84,348,646 S508G probably damaging Het
Fam198b T A 3: 79,886,807 L194* probably null Het
Fam214a T C 9: 75,004,351 C42R probably damaging Het
Fam71d C T 12: 78,712,208 P101S probably benign Het
Fgf10 A G 13: 118,789,123 E146G probably benign Het
Fsip2 A G 2: 82,993,237 D6438G possibly damaging Het
Gm3139 T A 5: 94,537,751 Y423* probably null Het
Gm49355 T A 14: 12,296,672 C10* probably null Het
Hfm1 A G 5: 106,901,703 probably null Het
Hivep3 T C 4: 120,132,219 S1956P probably damaging Het
Hrh2 A G 13: 54,221,251 S369G unknown Het
Hspg2 T C 4: 137,533,561 probably null Het
Hsph1 T C 5: 149,630,460 Y181C probably damaging Het
Kcnh8 A G 17: 52,894,117 probably null Het
Kctd1 C T 18: 15,062,643 E308K possibly damaging Het
Kdm8 A T 7: 125,460,931 Y335F probably damaging Het
Kif2b C G 11: 91,577,137 G107R probably benign Het
Lama4 G A 10: 38,965,733 probably benign Het
Lepr T C 4: 101,814,764 V995A probably benign Het
Mfsd4a A T 1: 132,052,393 V375E probably damaging Het
Mgl2 G T 11: 70,137,043 W359L probably damaging Het
Muc5b C A 7: 141,861,061 Y2581* probably null Het
Nol10 G T 12: 17,373,561 probably null Het
Olfr1297 T A 2: 111,621,193 M294L probably benign Het
Olfr665 A T 7: 104,881,141 K145* probably null Het
Otud3 C T 4: 138,909,554 V99M probably damaging Het
Parvb T C 15: 84,303,471 probably null Het
Pclo C A 5: 14,521,918 P439Q possibly damaging Het
Peg10 CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC CATC 6: 4,756,431 probably benign Het
Pkn1 A T 8: 83,692,673 H100Q possibly damaging Het
Plce1 A T 19: 38,760,137 I1771F probably damaging Het
Plxna2 G T 1: 194,801,058 R1559L possibly damaging Het
Ppp2r3a T A 9: 101,126,422 I416L possibly damaging Het
Robo1 C A 16: 72,960,151 C333* probably null Het
Ryr2 A T 13: 11,883,123 Y129N probably damaging Het
Schip1 A T 3: 68,617,699 K359M probably damaging Het
Schip1 G T 3: 68,617,700 K359N probably damaging Het
Sh2d2a T A 3: 87,848,361 S65T possibly damaging Het
Ssrp1 G A 2: 85,045,562 M588I probably benign Het
Stim2 T A 5: 54,116,128 C567S probably benign Het
Syne1 C A 10: 5,424,295 A171S probably benign Het
Tigd3 A G 19: 5,893,022 S27P probably benign Het
Vipr1 C A 9: 121,664,554 Q224K probably damaging Het
Vmn1r75 T A 7: 11,880,548 M69K possibly damaging Het
Vmn2r72 T G 7: 85,754,917 D22A probably benign Het
Zbtb24 G A 10: 41,464,476 V523I probably benign Het
Zbtb43 A G 2: 33,462,295 F20S probably benign Het
Other mutations in Atr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00640:Atr APN 9 95865052 missense probably damaging 1.00
IGL00922:Atr APN 9 95907345 missense probably damaging 0.97
IGL01020:Atr APN 9 95862783 missense probably damaging 1.00
IGL01345:Atr APN 9 95940949 missense probably damaging 1.00
IGL01364:Atr APN 9 95865624 missense probably benign 0.29
IGL01456:Atr APN 9 95950565 missense possibly damaging 0.62
IGL01534:Atr APN 9 95865546 missense probably damaging 0.99
IGL01761:Atr APN 9 95951448 splice site probably benign
IGL01791:Atr APN 9 95921781 missense probably benign 0.05
IGL01831:Atr APN 9 95870754 missense probably benign 0.18
IGL01973:Atr APN 9 95871674 missense probably damaging 1.00
IGL02008:Atr APN 9 95881420 splice site probably benign
IGL02016:Atr APN 9 95927175 missense probably benign 0.09
IGL02035:Atr APN 9 95866682 missense probably benign 0.01
IGL02058:Atr APN 9 95871487 missense probably damaging 0.99
IGL02081:Atr APN 9 95883205 missense probably damaging 1.00
IGL02224:Atr APN 9 95878629 missense probably damaging 0.98
IGL02234:Atr APN 9 95947250 splice site probably benign
IGL02367:Atr APN 9 95899141 nonsense probably null
IGL02621:Atr APN 9 95908400 missense probably benign 0.00
IGL02728:Atr APN 9 95936475 missense probably damaging 1.00
IGL02833:Atr APN 9 95862852 missense probably damaging 1.00
IGL02939:Atr APN 9 95865261 missense probably benign
IGL03107:Atr APN 9 95897730 missense probably benign 0.28
IGL03382:Atr APN 9 95920822 nonsense probably null
PIT4812001:Atr UTSW 9 95910649 missense probably benign 0.41
R0042:Atr UTSW 9 95927356 splice site probably benign
R0042:Atr UTSW 9 95927356 splice site probably benign
R0281:Atr UTSW 9 95937566 missense probably benign 0.26
R0282:Atr UTSW 9 95862798 missense probably benign 0.12
R0512:Atr UTSW 9 95935526 missense probably damaging 0.99
R0547:Atr UTSW 9 95899165 splice site probably benign
R0567:Atr UTSW 9 95865829 missense probably benign 0.00
R0631:Atr UTSW 9 95874777 missense possibly damaging 0.92
R1116:Atr UTSW 9 95867636 nonsense probably null
R1171:Atr UTSW 9 95907323 missense probably damaging 1.00
R1241:Atr UTSW 9 95950636 missense probably benign 0.08
R1345:Atr UTSW 9 95920355 missense probably benign 0.25
R1400:Atr UTSW 9 95862848 missense probably benign 0.32
R1413:Atr UTSW 9 95932442 missense probably damaging 1.00
R1527:Atr UTSW 9 95870043 missense possibly damaging 0.82
R1557:Atr UTSW 9 95871449 missense probably damaging 1.00
R1591:Atr UTSW 9 95945385 missense probably damaging 1.00
R1602:Atr UTSW 9 95951557 missense probably damaging 1.00
R1605:Atr UTSW 9 95936463 missense probably damaging 1.00
R1670:Atr UTSW 9 95861456 missense probably benign 0.38
R1709:Atr UTSW 9 95871076 missense probably benign 0.00
R1728:Atr UTSW 9 95897581 missense probably benign 0.01
R1729:Atr UTSW 9 95897581 missense probably benign 0.01
R1739:Atr UTSW 9 95897581 missense probably benign 0.01
R1816:Atr UTSW 9 95866694 missense probably benign 0.00
R1824:Atr UTSW 9 95936421 missense probably damaging 1.00
R1844:Atr UTSW 9 95905817 missense probably benign 0.01
R1857:Atr UTSW 9 95865097 missense probably damaging 1.00
R1858:Atr UTSW 9 95865097 missense probably damaging 1.00
R1866:Atr UTSW 9 95870605 splice site probably null
R1913:Atr UTSW 9 95866733 missense probably benign 0.01
R2042:Atr UTSW 9 95870022 missense probably benign 0.00
R2210:Atr UTSW 9 95907300 missense probably damaging 1.00
R2230:Atr UTSW 9 95920765 missense probably damaging 1.00
R2361:Atr UTSW 9 95871157 missense probably benign 0.41
R2399:Atr UTSW 9 95871599 missense probably benign 0.00
R2431:Atr UTSW 9 95862892 missense probably benign 0.24
R2860:Atr UTSW 9 95874243 missense probably benign 0.07
R2861:Atr UTSW 9 95874243 missense probably benign 0.07
R3019:Atr UTSW 9 95905818 missense possibly damaging 0.52
R3684:Atr UTSW 9 95920400 missense probably damaging 0.96
R4155:Atr UTSW 9 95888124 nonsense probably null
R4295:Atr UTSW 9 95874426 missense probably benign 0.04
R4359:Atr UTSW 9 95951536 missense probably damaging 1.00
R4506:Atr UTSW 9 95865237 missense probably benign 0.21
R4523:Atr UTSW 9 95862863 missense probably damaging 1.00
R4536:Atr UTSW 9 95874418 missense probably benign 0.26
R4588:Atr UTSW 9 95865667 missense probably benign
R4646:Atr UTSW 9 95871197 critical splice donor site probably null
R4702:Atr UTSW 9 95920355 missense possibly damaging 0.92
R4743:Atr UTSW 9 95862792 missense probably benign 0.14
R4782:Atr UTSW 9 95862797 missense probably benign 0.00
R4928:Atr UTSW 9 95907299 missense probably damaging 1.00
R5031:Atr UTSW 9 95865702 missense probably damaging 0.98
R5138:Atr UTSW 9 95937596 missense probably benign 0.15
R5188:Atr UTSW 9 95921725 missense probably benign 0.00
R5219:Atr UTSW 9 95881238 missense probably damaging 0.99
R5307:Atr UTSW 9 95878544 missense probably benign 0.01
R5414:Atr UTSW 9 95870704 missense probably benign 0.00
R5628:Atr UTSW 9 95874226 nonsense probably null
R5664:Atr UTSW 9 95905813 missense probably benign 0.00
R5678:Atr UTSW 9 95951487 nonsense probably null
R5724:Atr UTSW 9 95866588 missense probably damaging 1.00
R5759:Atr UTSW 9 95874402 missense probably benign 0.01
R5763:Atr UTSW 9 95945123 missense probably benign 0.04
R5922:Atr UTSW 9 95903682 missense probably benign 0.00
R6051:Atr UTSW 9 95908369 missense possibly damaging 0.85
R6161:Atr UTSW 9 95865319 missense probably benign
R6171:Atr UTSW 9 95881271 nonsense probably null
R6532:Atr UTSW 9 95908408 missense probably benign
R6774:Atr UTSW 9 95927213 missense probably benign 0.00
R6894:Atr UTSW 9 95927197 missense probably damaging 1.00
R6930:Atr UTSW 9 95866635 missense probably benign 0.21
R7018:Atr UTSW 9 95866694 missense probably benign 0.17
R7056:Atr UTSW 9 95862863 missense probably damaging 1.00
R7103:Atr UTSW 9 95865372 missense probably damaging 0.98
R7154:Atr UTSW 9 95865045 missense probably benign
R7157:Atr UTSW 9 95869900 missense probably benign 0.00
R7188:Atr UTSW 9 95862791 nonsense probably null
R7300:Atr UTSW 9 95865370 missense probably benign 0.00
R7337:Atr UTSW 9 95871448 missense probably damaging 1.00
X0019:Atr UTSW 9 95940871 missense probably damaging 1.00
Z1088:Atr UTSW 9 95885320 intron probably null
Predicted Primers PCR Primer
(F):5'- ATCTGTGGAGCTTCCTGGTC -3'
(R):5'- GCAAATATGACTTGTGGGAGCATG -3'

Sequencing Primer
(F):5'- CAGCCTGGTCTACAAAGTGAGTTC -3'
(R):5'- TGTGATATTCAGAAAAGCAGCAAAG -3'
Posted On2019-06-26