Incidental Mutation 'R7189:Ppp2r3a'
ID559501
Institutional Source Beutler Lab
Gene Symbol Ppp2r3a
Ensembl Gene ENSMUSG00000043154
Gene Nameprotein phosphatase 2, regulatory subunit B'', alpha
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7189 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location101105084-101251795 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 101126422 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 416 (I416L)
Ref Sequence ENSEMBL: ENSMUSP00000069688 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066773] [ENSMUST00000075941]
Predicted Effect possibly damaging
Transcript: ENSMUST00000066773
AA Change: I416L

PolyPhen 2 Score 0.586 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000069688
Gene: ENSMUSG00000043154
AA Change: I416L

DomainStartEndE-ValueType
Blast:EFh 140 169 1e-9 BLAST
Pfam:EF-hand_7 282 380 2.6e-17 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000075941
AA Change: I1036L

PolyPhen 2 Score 0.510 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000075327
Gene: ENSMUSG00000043154
AA Change: I1036L

DomainStartEndE-ValueType
low complexity region 248 266 N/A INTRINSIC
Blast:EFh 760 789 1e-9 BLAST
Pfam:EF-hand_7 902 1000 2.5e-17 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 95% (57/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the regulatory subunits of the protein phosphatase 2. Protein phosphatase 2 (formerly named type 2A) is one of the four major Ser/Thr phosphatases and is implicated in the negative control of cell growth and division. Protein phosphatase 2 holoenzymes are heterotrimeric proteins composed of a structural subunit A, a catalytic subunit C, and a regulatory subunit B. The regulatory subunit is encoded by a diverse set of genes that have been grouped into the B/PR55, B'/PR61, and B''/PR72 families. These different regulatory subunits confer distinct enzymatic specificities and intracellular localizations to the holozenzyme. The product of this gene belongs to the B'' family. The B'' family has been further divided into subfamilies. The product of this gene belongs to the alpha subfamily of regulatory subunit B''. Alternative splicing results in multiple transcript variants encoding different isoforms.[provided by RefSeq, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 G T 2: 103,567,516 A264S probably benign Het
Atr G T 9: 95,862,791 E54* probably null Het
Bmp4 A G 14: 46,383,999 S363P probably damaging Het
Cfap54 C A 10: 92,937,728 A2077S unknown Het
Chrna7 T C 7: 63,106,027 D257G probably damaging Het
Chrnd C T 1: 87,191,058 R46W probably damaging Het
Cntn2 A G 1: 132,517,086 I851T probably damaging Het
Col3a1 T A 1: 45,333,657 I534K unknown Het
Cyp3a25 A T 5: 146,003,060 L46I probably benign Het
Dnah7b G C 1: 46,242,142 G2788R probably damaging Het
Dnpep T C 1: 75,313,430 E301G probably damaging Het
Efcab3 T C 11: 105,095,864 S30P probably benign Het
Elk4 A G 1: 132,019,389 I373V probably damaging Het
Fam161b T C 12: 84,348,646 S508G probably damaging Het
Fam198b T A 3: 79,886,807 L194* probably null Het
Fam214a T C 9: 75,004,351 C42R probably damaging Het
Fam71d C T 12: 78,712,208 P101S probably benign Het
Fgf10 A G 13: 118,789,123 E146G probably benign Het
Fsip2 A G 2: 82,993,237 D6438G possibly damaging Het
Gm3139 T A 5: 94,537,751 Y423* probably null Het
Gm49355 T A 14: 12,296,672 C10* probably null Het
Hfm1 A G 5: 106,901,703 probably null Het
Hivep3 T C 4: 120,132,219 S1956P probably damaging Het
Hrh2 A G 13: 54,221,251 S369G unknown Het
Hspg2 T C 4: 137,533,561 probably null Het
Hsph1 T C 5: 149,630,460 Y181C probably damaging Het
Kcnh8 A G 17: 52,894,117 probably null Het
Kctd1 C T 18: 15,062,643 E308K possibly damaging Het
Kdm8 A T 7: 125,460,931 Y335F probably damaging Het
Kif2b C G 11: 91,577,137 G107R probably benign Het
Lama4 G A 10: 38,965,733 probably benign Het
Lepr T C 4: 101,814,764 V995A probably benign Het
Mfsd4a A T 1: 132,052,393 V375E probably damaging Het
Mgl2 G T 11: 70,137,043 W359L probably damaging Het
Muc5b C A 7: 141,861,061 Y2581* probably null Het
Nol10 G T 12: 17,373,561 probably null Het
Olfr1297 T A 2: 111,621,193 M294L probably benign Het
Olfr665 A T 7: 104,881,141 K145* probably null Het
Otud3 C T 4: 138,909,554 V99M probably damaging Het
Parvb T C 15: 84,303,471 probably null Het
Pclo C A 5: 14,521,918 P439Q possibly damaging Het
Peg10 CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC CATC 6: 4,756,431 probably benign Het
Pkn1 A T 8: 83,692,673 H100Q possibly damaging Het
Plce1 A T 19: 38,760,137 I1771F probably damaging Het
Plxna2 G T 1: 194,801,058 R1559L possibly damaging Het
Robo1 C A 16: 72,960,151 C333* probably null Het
Ryr2 A T 13: 11,883,123 Y129N probably damaging Het
Schip1 A T 3: 68,617,699 K359M probably damaging Het
Schip1 G T 3: 68,617,700 K359N probably damaging Het
Sh2d2a T A 3: 87,848,361 S65T possibly damaging Het
Ssrp1 G A 2: 85,045,562 M588I probably benign Het
Stim2 T A 5: 54,116,128 C567S probably benign Het
Syne1 C A 10: 5,424,295 A171S probably benign Het
Tigd3 A G 19: 5,893,022 S27P probably benign Het
Vipr1 C A 9: 121,664,554 Q224K probably damaging Het
Vmn1r75 T A 7: 11,880,548 M69K possibly damaging Het
Vmn2r72 T G 7: 85,754,917 D22A probably benign Het
Zbtb24 G A 10: 41,464,476 V523I probably benign Het
Zbtb43 A G 2: 33,462,295 F20S probably benign Het
Other mutations in Ppp2r3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00792:Ppp2r3a APN 9 101211301 missense possibly damaging 0.50
IGL01122:Ppp2r3a APN 9 101211645 missense probably benign 0.30
IGL02332:Ppp2r3a APN 9 101180403 missense possibly damaging 0.78
IGL02653:Ppp2r3a APN 9 101211693 missense probably benign 0.13
IGL03329:Ppp2r3a APN 9 101126431 splice site probably benign
IGL03351:Ppp2r3a APN 9 101211192 missense probably benign 0.00
lank UTSW 9 101198630 critical splice donor site probably null
PIT4480001:Ppp2r3a UTSW 9 101126377 missense possibly damaging 0.95
PIT4687001:Ppp2r3a UTSW 9 101144380 missense probably benign 0.00
R0243:Ppp2r3a UTSW 9 101212284 missense probably damaging 1.00
R1004:Ppp2r3a UTSW 9 101198630 critical splice donor site probably null
R1086:Ppp2r3a UTSW 9 101153822 missense possibly damaging 0.67
R1215:Ppp2r3a UTSW 9 101212684 missense probably benign 0.02
R1245:Ppp2r3a UTSW 9 101194394 missense probably damaging 0.99
R1458:Ppp2r3a UTSW 9 101211312 missense probably damaging 1.00
R1682:Ppp2r3a UTSW 9 101212306 missense probably benign 0.00
R1857:Ppp2r3a UTSW 9 101212893 missense probably damaging 0.96
R1972:Ppp2r3a UTSW 9 101211777 missense probably benign 0.00
R2029:Ppp2r3a UTSW 9 101145481 missense probably damaging 1.00
R2076:Ppp2r3a UTSW 9 101144371 missense possibly damaging 0.83
R2135:Ppp2r3a UTSW 9 101211558 missense probably damaging 0.99
R2180:Ppp2r3a UTSW 9 101127015 nonsense probably null
R3155:Ppp2r3a UTSW 9 101212360 missense possibly damaging 0.56
R4797:Ppp2r3a UTSW 9 101211980 missense probably benign 0.01
R4829:Ppp2r3a UTSW 9 101212510 missense possibly damaging 0.67
R5269:Ppp2r3a UTSW 9 101153865 missense probably damaging 0.98
R5917:Ppp2r3a UTSW 9 101211984 missense probably benign 0.10
R5939:Ppp2r3a UTSW 9 101212625 missense probably benign 0.37
R6089:Ppp2r3a UTSW 9 101211636 missense probably benign 0.00
R6254:Ppp2r3a UTSW 9 101148587 missense possibly damaging 0.75
R6574:Ppp2r3a UTSW 9 101194385 missense probably benign 0.03
R6776:Ppp2r3a UTSW 9 101212862 missense probably benign 0.00
R6927:Ppp2r3a UTSW 9 101175348 missense probably damaging 1.00
R7190:Ppp2r3a UTSW 9 101212527 missense probably benign 0.11
R7288:Ppp2r3a UTSW 9 101127004 missense probably damaging 0.98
R7292:Ppp2r3a UTSW 9 101212672 missense probably damaging 0.96
X0020:Ppp2r3a UTSW 9 101212039 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- ATATACCTTTGGTACTCCAGCTCTG -3'
(R):5'- GAAACTACAGTTCTTTGCTGGGTG -3'

Sequencing Primer
(F):5'- GGTACTCCAGCTCTGAGAGTTC -3'
(R):5'- TGTTACAGTGTTGATGGTTATACATC -3'
Posted On2019-06-26