Incidental Mutation 'R7189:Parvb'
ID559517
Institutional Source Beutler Lab
Gene Symbol Parvb
Ensembl Gene ENSMUSG00000022438
Gene Nameparvin, beta
Synonymsaffixin, D15Gsk1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7189 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location84232043-84315688 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 84303471 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000023072 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023072]
Predicted Effect probably null
Transcript: ENSMUST00000023072
SMART Domains Protein: ENSMUSP00000023072
Gene: ENSMUSG00000022438

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
CH 90 190 3.46e-1 SMART
low complexity region 204 211 N/A INTRINSIC
CH 257 360 9.18e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 95% (57/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the parvin family of actin-binding proteins, which play a role in cytoskeleton organization and cell adhesion. These proteins are associated with focal contacts and contain calponin homology domains that bind to actin filaments. This family member binds to alphaPIX and alpha-actinin, and it can inhibit the activity of integrin-linked kinase. This protein also functions in tumor suppression. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Disruption of this marker has no apparent adverse consequences. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 G T 2: 103,567,516 A264S probably benign Het
Atr G T 9: 95,862,791 E54* probably null Het
Bmp4 A G 14: 46,383,999 S363P probably damaging Het
Cfap54 C A 10: 92,937,728 A2077S unknown Het
Chrna7 T C 7: 63,106,027 D257G probably damaging Het
Chrnd C T 1: 87,191,058 R46W probably damaging Het
Cntn2 A G 1: 132,517,086 I851T probably damaging Het
Col3a1 T A 1: 45,333,657 I534K unknown Het
Cyp3a25 A T 5: 146,003,060 L46I probably benign Het
Dnah7b G C 1: 46,242,142 G2788R probably damaging Het
Dnpep T C 1: 75,313,430 E301G probably damaging Het
Efcab3 T C 11: 105,095,864 S30P probably benign Het
Elk4 A G 1: 132,019,389 I373V probably damaging Het
Fam161b T C 12: 84,348,646 S508G probably damaging Het
Fam198b T A 3: 79,886,807 L194* probably null Het
Fam214a T C 9: 75,004,351 C42R probably damaging Het
Fam71d C T 12: 78,712,208 P101S probably benign Het
Fgf10 A G 13: 118,789,123 E146G probably benign Het
Fsip2 A G 2: 82,993,237 D6438G possibly damaging Het
Gm3139 T A 5: 94,537,751 Y423* probably null Het
Gm49355 T A 14: 12,296,672 C10* probably null Het
Hfm1 A G 5: 106,901,703 probably null Het
Hivep3 T C 4: 120,132,219 S1956P probably damaging Het
Hrh2 A G 13: 54,221,251 S369G unknown Het
Hspg2 T C 4: 137,533,561 probably null Het
Hsph1 T C 5: 149,630,460 Y181C probably damaging Het
Kcnh8 A G 17: 52,894,117 probably null Het
Kctd1 C T 18: 15,062,643 E308K possibly damaging Het
Kdm8 A T 7: 125,460,931 Y335F probably damaging Het
Kif2b C G 11: 91,577,137 G107R probably benign Het
Lama4 G A 10: 38,965,733 probably benign Het
Lepr T C 4: 101,814,764 V995A probably benign Het
Mfsd4a A T 1: 132,052,393 V375E probably damaging Het
Mgl2 G T 11: 70,137,043 W359L probably damaging Het
Muc5b C A 7: 141,861,061 Y2581* probably null Het
Nol10 G T 12: 17,373,561 probably null Het
Olfr1297 T A 2: 111,621,193 M294L probably benign Het
Olfr665 A T 7: 104,881,141 K145* probably null Het
Otud3 C T 4: 138,909,554 V99M probably damaging Het
Pclo C A 5: 14,521,918 P439Q possibly damaging Het
Peg10 CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC CATC 6: 4,756,431 probably benign Het
Pkn1 A T 8: 83,692,673 H100Q possibly damaging Het
Plce1 A T 19: 38,760,137 I1771F probably damaging Het
Plxna2 G T 1: 194,801,058 R1559L possibly damaging Het
Ppp2r3a T A 9: 101,126,422 I416L possibly damaging Het
Robo1 C A 16: 72,960,151 C333* probably null Het
Ryr2 A T 13: 11,883,123 Y129N probably damaging Het
Schip1 A T 3: 68,617,699 K359M probably damaging Het
Schip1 G T 3: 68,617,700 K359N probably damaging Het
Sh2d2a T A 3: 87,848,361 S65T possibly damaging Het
Ssrp1 G A 2: 85,045,562 M588I probably benign Het
Stim2 T A 5: 54,116,128 C567S probably benign Het
Syne1 C A 10: 5,424,295 A171S probably benign Het
Tigd3 A G 19: 5,893,022 S27P probably benign Het
Vipr1 C A 9: 121,664,554 Q224K probably damaging Het
Vmn1r75 T A 7: 11,880,548 M69K possibly damaging Het
Vmn2r72 T G 7: 85,754,917 D22A probably benign Het
Zbtb24 G A 10: 41,464,476 V523I probably benign Het
Zbtb43 A G 2: 33,462,295 F20S probably benign Het
Other mutations in Parvb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01610:Parvb APN 15 84303465 missense probably damaging 1.00
IGL02415:Parvb APN 15 84292815 missense probably damaging 1.00
IGL02458:Parvb APN 15 84303434 missense probably damaging 1.00
IGL02937:Parvb APN 15 84308953 missense probably damaging 1.00
IGL03088:Parvb APN 15 84308843 splice site probably benign
R0422:Parvb UTSW 15 84295611 missense probably benign 0.28
R1470:Parvb UTSW 15 84271252 missense probably damaging 1.00
R1470:Parvb UTSW 15 84271308 missense probably benign 0.00
R1470:Parvb UTSW 15 84271252 missense probably damaging 1.00
R1470:Parvb UTSW 15 84271308 missense probably benign 0.00
R1713:Parvb UTSW 15 84297991 splice site probably benign
R2031:Parvb UTSW 15 84282835 missense probably benign 0.09
R2146:Parvb UTSW 15 84232168 missense possibly damaging 0.63
R2148:Parvb UTSW 15 84232168 missense possibly damaging 0.63
R2149:Parvb UTSW 15 84232168 missense possibly damaging 0.63
R2150:Parvb UTSW 15 84232168 missense possibly damaging 0.63
R2508:Parvb UTSW 15 84297970 missense probably benign
R4770:Parvb UTSW 15 84303905 critical splice donor site probably null
R5948:Parvb UTSW 15 84303461 missense probably damaging 1.00
R6492:Parvb UTSW 15 84303872 missense probably damaging 1.00
R6718:Parvb UTSW 15 84297979 missense probably damaging 0.96
R6719:Parvb UTSW 15 84297979 missense probably damaging 0.96
R6720:Parvb UTSW 15 84297979 missense probably damaging 0.96
R6722:Parvb UTSW 15 84297979 missense probably damaging 0.96
R7285:Parvb UTSW 15 84282784 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AGCAACCAGAGAGGGCTATTTC -3'
(R):5'- AGGCTGTGTCAAACTCTAGGC -3'

Sequencing Primer
(F):5'- CCAGAGAGGGCTATTTCTAGAACTG -3'
(R):5'- GCTGTGTCAAACTCTAGGCTCTAG -3'
Posted On2019-06-26