Incidental Mutation 'R7190:Ppp2r3a'
ID559553
Institutional Source Beutler Lab
Gene Symbol Ppp2r3a
Ensembl Gene ENSMUSG00000043154
Gene Nameprotein phosphatase 2, regulatory subunit B'', alpha
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7190 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location101105084-101251795 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 101212527 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 199 (M199K)
Ref Sequence ENSEMBL: ENSMUSP00000075327 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075941]
Predicted Effect probably benign
Transcript: ENSMUST00000075941
AA Change: M199K

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000075327
Gene: ENSMUSG00000043154
AA Change: M199K

DomainStartEndE-ValueType
low complexity region 248 266 N/A INTRINSIC
Blast:EFh 760 789 1e-9 BLAST
Pfam:EF-hand_7 902 1000 2.5e-17 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the regulatory subunits of the protein phosphatase 2. Protein phosphatase 2 (formerly named type 2A) is one of the four major Ser/Thr phosphatases and is implicated in the negative control of cell growth and division. Protein phosphatase 2 holoenzymes are heterotrimeric proteins composed of a structural subunit A, a catalytic subunit C, and a regulatory subunit B. The regulatory subunit is encoded by a diverse set of genes that have been grouped into the B/PR55, B'/PR61, and B''/PR72 families. These different regulatory subunits confer distinct enzymatic specificities and intracellular localizations to the holozenzyme. The product of this gene belongs to the B'' family. The B'' family has been further divided into subfamilies. The product of this gene belongs to the alpha subfamily of regulatory subunit B''. Alternative splicing results in multiple transcript variants encoding different isoforms.[provided by RefSeq, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Add3 C T 19: 53,216,899 R27* probably null Het
Armc3 T A 2: 19,293,136 Y573N probably damaging Het
BC024978 G A 7: 27,201,123 A176T probably damaging Het
Bod1l A C 5: 41,819,938 N1344K probably benign Het
Camta1 T G 4: 151,148,523 N231T possibly damaging Het
Capza2 T A 6: 17,654,121 Y57* probably null Het
Ccdc186 T A 19: 56,792,000 I871F probably damaging Het
Cntnap5b A G 1: 100,431,849 probably null Het
Dnah2 G T 11: 69,549,097 probably null Het
Fhod3 T C 18: 25,090,755 F1053L probably damaging Het
Foxj1 A G 11: 116,332,375 Y201H possibly damaging Het
Gatad2b T A 3: 90,350,415 I210N probably benign Het
Gba T A 3: 89,204,362 I112N probably damaging Het
Gbp2 T C 3: 142,633,447 V420A probably benign Het
Gm3106 T G 5: 94,218,237 N71K probably benign Het
Gm8251 A C 1: 44,061,615 S108A probably benign Het
Golga3 T A 5: 110,209,855 H1072Q probably damaging Het
Gpr150 C T 13: 76,055,873 A318T probably benign Het
Gpr6 T C 10: 41,070,960 N209D probably damaging Het
Grin2b T C 6: 135,732,948 N1200S possibly damaging Het
Ifi207 G A 1: 173,730,252 H307Y unknown Het
Il20ra A T 10: 19,742,941 I46F probably damaging Het
Lvrn A G 18: 46,900,503 D927G probably benign Het
Nlrc4 G T 17: 74,445,203 D728E probably damaging Het
Nup107 T C 10: 117,762,135 D630G probably benign Het
Olfr378 A T 11: 73,425,164 I273N probably benign Het
Olfr787 T C 10: 129,462,757 I27T probably benign Het
Pclo C A 5: 14,679,729 A2867D unknown Het
Perm1 A G 4: 156,219,815 T754A possibly damaging Het
Plpbp G T 8: 27,051,297 V162L probably benign Het
Plscr4 A T 9: 92,488,641 E220D probably benign Het
Rassf6 T C 5: 90,606,807 E204G probably damaging Het
Reln A C 5: 22,047,947 D667E probably damaging Het
Rere A G 4: 150,610,953 I462V unknown Het
Rpain A G 11: 70,971,909 E76G possibly damaging Het
Strc T G 2: 121,369,026 I1311L probably benign Het
Svil A G 18: 5,092,937 M1385V probably benign Het
Syne2 T A 12: 76,066,587 D1083E probably benign Het
Szt2 T A 4: 118,389,006 H986L probably damaging Het
Tcl1b2 G T 12: 105,147,234 probably null Het
Thy1 T A 9: 44,046,925 S117T possibly damaging Het
Tmem183a A T 1: 134,354,758 I203N probably damaging Het
Tmprss11g T C 5: 86,496,632 I118V probably benign Het
Tsen34 T C 7: 3,694,807 V69A possibly damaging Het
Ttn T C 2: 76,886,799 Q7506R unknown Het
Vmn1r184 T C 7: 26,267,680 S284P probably damaging Het
Wdr19 A G 5: 65,240,862 D810G probably benign Het
Zer1 T C 2: 30,103,432 D554G probably damaging Het
Zfp626 A T 7: 27,818,343 T250S probably benign Het
Other mutations in Ppp2r3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00792:Ppp2r3a APN 9 101211301 missense possibly damaging 0.50
IGL01122:Ppp2r3a APN 9 101211645 missense probably benign 0.30
IGL02332:Ppp2r3a APN 9 101180403 missense possibly damaging 0.78
IGL02653:Ppp2r3a APN 9 101211693 missense probably benign 0.13
IGL03329:Ppp2r3a APN 9 101126431 splice site probably benign
IGL03351:Ppp2r3a APN 9 101211192 missense probably benign 0.00
lank UTSW 9 101198630 critical splice donor site probably null
PIT4480001:Ppp2r3a UTSW 9 101126377 missense possibly damaging 0.95
PIT4687001:Ppp2r3a UTSW 9 101144380 missense probably benign 0.00
R0243:Ppp2r3a UTSW 9 101212284 missense probably damaging 1.00
R1004:Ppp2r3a UTSW 9 101198630 critical splice donor site probably null
R1086:Ppp2r3a UTSW 9 101153822 missense possibly damaging 0.67
R1215:Ppp2r3a UTSW 9 101212684 missense probably benign 0.02
R1245:Ppp2r3a UTSW 9 101194394 missense probably damaging 0.99
R1458:Ppp2r3a UTSW 9 101211312 missense probably damaging 1.00
R1682:Ppp2r3a UTSW 9 101212306 missense probably benign 0.00
R1857:Ppp2r3a UTSW 9 101212893 missense probably damaging 0.96
R1972:Ppp2r3a UTSW 9 101211777 missense probably benign 0.00
R2029:Ppp2r3a UTSW 9 101145481 missense probably damaging 1.00
R2076:Ppp2r3a UTSW 9 101144371 missense possibly damaging 0.83
R2135:Ppp2r3a UTSW 9 101211558 missense probably damaging 0.99
R2180:Ppp2r3a UTSW 9 101127015 nonsense probably null
R3155:Ppp2r3a UTSW 9 101212360 missense possibly damaging 0.56
R4797:Ppp2r3a UTSW 9 101211980 missense probably benign 0.01
R4829:Ppp2r3a UTSW 9 101212510 missense possibly damaging 0.67
R5269:Ppp2r3a UTSW 9 101153865 missense probably damaging 0.98
R5917:Ppp2r3a UTSW 9 101211984 missense probably benign 0.10
R5939:Ppp2r3a UTSW 9 101212625 missense probably benign 0.37
R6089:Ppp2r3a UTSW 9 101211636 missense probably benign 0.00
R6254:Ppp2r3a UTSW 9 101148587 missense possibly damaging 0.75
R6574:Ppp2r3a UTSW 9 101194385 missense probably benign 0.03
R6776:Ppp2r3a UTSW 9 101212862 missense probably benign 0.00
R6927:Ppp2r3a UTSW 9 101175348 missense probably damaging 1.00
R7189:Ppp2r3a UTSW 9 101126422 missense possibly damaging 0.59
R7288:Ppp2r3a UTSW 9 101127004 missense probably damaging 0.98
R7292:Ppp2r3a UTSW 9 101212672 missense probably damaging 0.96
X0020:Ppp2r3a UTSW 9 101212039 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- TAGAAATCACCTCATTGCCACTTC -3'
(R):5'- CCATGCAGCTTACAGAAAAGG -3'

Sequencing Primer
(F):5'- TCACTGATACTACCTCCCGAC -3'
(R):5'- TGCAGCTTACAGAAAAGGAAGAAAAG -3'
Posted On2019-06-26