Incidental Mutation 'R0591:1110002E22Rik'
List |< first << previous [record 91 of 386652] next >> last >|
ID55965
Institutional Source Beutler Lab
Gene Symbol 1110002E22Rik
Ensembl Gene ENSMUSG00000090066
Gene NameRIKEN cDNA 1110002E22 gene
Synonyms
MMRRC Submission 038781-MU
Accession Numbers
Stock #R0591 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location138065052-138081506 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 138068943 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 1298 (E1298*)
Ref Sequence ENSEMBL: ENSMUSP00000123851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163080]
Predicted Effect probably null
Transcript: ENSMUST00000163080
AA Change: E1298*
SMART Domains Protein: ENSMUSP00000123851
Gene: ENSMUSG00000090066
AA Change: E1298*

DomainStartEndE-ValueType
low complexity region 44 55 N/A INTRINSIC
low complexity region 87 102 N/A INTRINSIC
low complexity region 229 247 N/A INTRINSIC
low complexity region 422 438 N/A INTRINSIC
low complexity region 459 505 N/A INTRINSIC
low complexity region 667 680 N/A INTRINSIC
low complexity region 937 948 N/A INTRINSIC
low complexity region 995 1007 N/A INTRINSIC
low complexity region 1105 1115 N/A INTRINSIC
low complexity region 1224 1242 N/A INTRINSIC
low complexity region 1376 1385 N/A INTRINSIC
Pfam:DUF4585 1598 1667 6.9e-32 PFAM
low complexity region 1723 1738 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.2%
  • 10x: 97.7%
  • 20x: 95.3%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030617O03Rik T C 12: 100,859,518 probably benign Het
Adam19 T C 11: 46,121,411 probably benign Het
Agt A T 8: 124,556,939 S480R possibly damaging Het
Anapc1 G T 2: 128,619,332 D1769E probably benign Het
Aox4 T C 1: 58,239,102 probably benign Het
Apol9a G A 15: 77,735,630 V209I possibly damaging Het
Appl2 A T 10: 83,624,645 I116K possibly damaging Het
B230118H07Rik A T 2: 101,576,117 D155E probably benign Het
BC051665 A G 13: 60,784,608 probably benign Het
Cactin G T 10: 81,324,003 E403* probably null Het
Carf G T 1: 60,125,914 probably benign Het
Ccdc167 A G 17: 29,705,261 probably benign Het
Ceacam3 G A 7: 17,151,883 probably null Het
Clca4b T A 3: 144,915,592 K574* probably null Het
Crabp1 T A 9: 54,765,603 I64N probably damaging Het
Dgkd T A 1: 87,915,104 I118N probably damaging Het
Dock10 C T 1: 80,541,219 probably benign Het
Ednrb A T 14: 103,823,274 probably null Het
Ercc6 T C 14: 32,558,016 probably benign Het
Gm5538 C A 3: 59,752,129 Y334* probably null Het
Golga3 A C 5: 110,188,743 Q416P probably damaging Het
Gpr12 A G 5: 146,583,635 V159A probably benign Het
Heatr5a A T 12: 51,910,101 probably benign Het
Helz2 A G 2: 181,232,116 I2195T possibly damaging Het
Hsd11b1 T C 1: 193,229,676 probably benign Het
Inhba A T 13: 16,026,820 K322N probably damaging Het
Katnal1 A T 5: 148,892,516 F291L probably damaging Het
Kcnj9 T C 1: 172,323,098 E316G probably damaging Het
l7Rn6 A T 7: 89,920,087 N175K probably benign Het
Lrsam1 A G 2: 32,933,923 probably benign Het
Mcf2l T G 8: 13,018,751 S1138A probably benign Het
Mios T C 6: 8,215,470 V222A possibly damaging Het
Mycbp2 A T 14: 103,196,391 probably benign Het
Nars A T 18: 64,500,567 I544N probably damaging Het
Olfr993 A G 2: 85,414,690 L63P possibly damaging Het
Pbrm1 A G 14: 31,046,430 probably benign Het
Plcb4 A G 2: 135,955,012 probably benign Het
Pnliprp1 A G 19: 58,734,706 D213G probably damaging Het
Psap A G 10: 60,300,855 N538D probably benign Het
Ptdss1 A G 13: 66,972,650 probably benign Het
Rap1b G A 10: 117,818,617 probably benign Het
Rhcg T A 7: 79,594,772 probably benign Het
Ryr1 G A 7: 29,104,795 T543I probably benign Het
Samm50 G A 15: 84,211,168 G452R probably benign Het
Scin A G 12: 40,080,930 probably null Het
Sesn3 T C 9: 14,308,558 L81S probably damaging Het
Skint6 A C 4: 112,858,169 probably benign Het
Slc30a4 A T 2: 122,685,240 L411H probably damaging Het
Slc44a5 C T 3: 154,234,145 probably benign Het
Slc4a3 C T 1: 75,549,021 A255V probably benign Het
Slc9b1 A G 3: 135,382,832 N318S possibly damaging Het
Tcp11l2 A T 10: 84,604,594 H287L probably benign Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tnks2 T A 19: 36,872,562 Y605N probably damaging Het
Topbp1 T A 9: 103,349,838 N1490K probably benign Het
Ube4bos1 T G 4: 149,357,577 probably benign Het
Usp4 G A 9: 108,348,029 probably benign Het
Vezf1 A T 11: 88,068,435 probably null Homo
Vezf1 T A 11: 88,068,436 probably benign Homo
Vmn1r184 A T 7: 26,267,075 D82V probably damaging Het
Other mutations in 1110002E22Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0026:1110002E22Rik UTSW 3 138066805 missense possibly damaging 0.95
R0047:1110002E22Rik UTSW 3 138066264 missense probably damaging 0.97
R0047:1110002E22Rik UTSW 3 138066264 missense probably damaging 0.97
R0102:1110002E22Rik UTSW 3 138068113 missense probably damaging 1.00
R0102:1110002E22Rik UTSW 3 138068113 missense probably damaging 1.00
R0197:1110002E22Rik UTSW 3 138069871 missense probably damaging 1.00
R0239:1110002E22Rik UTSW 3 138065834 small deletion unknown
R0394:1110002E22Rik UTSW 3 138067304 missense probably damaging 0.99
R0401:1110002E22Rik UTSW 3 138070306 missense possibly damaging 0.73
R0496:1110002E22Rik UTSW 3 138068244 missense probably damaging 1.00
R0711:1110002E22Rik UTSW 3 138068225 missense probably damaging 0.99
R0883:1110002E22Rik UTSW 3 138069871 missense probably damaging 1.00
R0908:1110002E22Rik UTSW 3 138070077 missense probably damaging 0.99
R0968:1110002E22Rik UTSW 3 138067206 missense probably damaging 0.99
R1023:1110002E22Rik UTSW 3 138066871 missense probably damaging 1.00
R1168:1110002E22Rik UTSW 3 138067900 missense probably benign 0.20
R1472:1110002E22Rik UTSW 3 138067552 missense possibly damaging 0.95
R1538:1110002E22Rik UTSW 3 138065401 missense probably benign 0.02
R1648:1110002E22Rik UTSW 3 138069420 missense probably benign 0.18
R1800:1110002E22Rik UTSW 3 138066718 missense probably damaging 1.00
R1919:1110002E22Rik UTSW 3 138067270 missense probably damaging 0.99
R1974:1110002E22Rik UTSW 3 138067267 missense probably damaging 1.00
R1990:1110002E22Rik UTSW 3 138065658 nonsense probably null
R1991:1110002E22Rik UTSW 3 138065658 nonsense probably null
R2102:1110002E22Rik UTSW 3 138065173 missense probably damaging 0.99
R2761:1110002E22Rik UTSW 3 138067780 missense probably damaging 0.99
R2899:1110002E22Rik UTSW 3 138065682 missense probably benign 0.00
R3618:1110002E22Rik UTSW 3 138068407 missense probably damaging 1.00
R3904:1110002E22Rik UTSW 3 138066639 missense probably benign 0.15
R3955:1110002E22Rik UTSW 3 138068073 missense probably benign 0.00
R4520:1110002E22Rik UTSW 3 138070266 missense probably damaging 0.99
R4619:1110002E22Rik UTSW 3 138069759 missense probably damaging 0.99
R4736:1110002E22Rik UTSW 3 138068485 missense probably damaging 0.99
R4752:1110002E22Rik UTSW 3 138069990 missense possibly damaging 0.91
R4777:1110002E22Rik UTSW 3 138065742 missense probably benign 0.09
R4780:1110002E22Rik UTSW 3 138065370 missense probably benign 0.02
R4824:1110002E22Rik UTSW 3 138065676 missense probably benign 0.00
R4829:1110002E22Rik UTSW 3 138069019 missense probably damaging 0.99
R4965:1110002E22Rik UTSW 3 138069672 missense probably benign
R5206:1110002E22Rik UTSW 3 138066511 missense probably benign 0.00
R5212:1110002E22Rik UTSW 3 138065850 missense possibly damaging 0.85
R5373:1110002E22Rik UTSW 3 138067635 missense probably benign
R5374:1110002E22Rik UTSW 3 138067635 missense probably benign
R5506:1110002E22Rik UTSW 3 138067947 missense probably damaging 1.00
R5528:1110002E22Rik UTSW 3 138066499 missense probably benign
R5536:1110002E22Rik UTSW 3 138066388 missense possibly damaging 0.89
R5587:1110002E22Rik UTSW 3 138065409 missense probably benign
R5759:1110002E22Rik UTSW 3 138068658 missense probably benign
R5933:1110002E22Rik UTSW 3 138070348 missense probably damaging 1.00
R5957:1110002E22Rik UTSW 3 138070161 missense probably benign
X0003:1110002E22Rik UTSW 3 138069096 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATTGTCTCCAAAGCGTCTGCTC -3'
(R):5'- GCTGCAAAGGTTGTGTTCTTTCCAC -3'

Sequencing Primer
(F):5'- CAAAGCGTCTGCTCAGAGG -3'
(R):5'- CCACATCTTTGTGGACTGGAG -3'
Posted OnJul 11, 2013