Incidental Mutation 'R7192:Il6st'
ID559679
Institutional Source Beutler Lab
Gene Symbol Il6st
Ensembl Gene ENSMUSG00000021756
Gene Nameinterleukin 6 signal transducer
SynonymsD13Ertd699e, gp130, CD130, 5133400A03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7192 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location112464070-112510086 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 112495207 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 427 (N427D)
Ref Sequence ENSEMBL: ENSMUSP00000138836 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070731] [ENSMUST00000183513] [ENSMUST00000183663] [ENSMUST00000183829] [ENSMUST00000184276] [ENSMUST00000184311] [ENSMUST00000184445] [ENSMUST00000184949]
Predicted Effect probably benign
Transcript: ENSMUST00000070731
AA Change: N427D

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000064205
Gene: ENSMUSG00000021756
AA Change: N427D

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Lep_receptor_Ig 26 112 1.4e-30 PFAM
FN3 126 205 1.15e1 SMART
FN3 220 306 7.23e-8 SMART
FN3 324 407 1.07e1 SMART
FN3 422 503 6.1e0 SMART
FN3 517 600 4.81e-4 SMART
transmembrane domain 618 640 N/A INTRINSIC
low complexity region 718 753 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183513
SMART Domains Protein: ENSMUSP00000139016
Gene: ENSMUSG00000021756

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183663
AA Change: N427D

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000138836
Gene: ENSMUSG00000021756
AA Change: N427D

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Lep_receptor_Ig 24 114 1.2e-32 PFAM
FN3 126 205 1.15e1 SMART
FN3 220 306 7.23e-8 SMART
FN3 324 407 1.07e1 SMART
FN3 422 503 6.1e0 SMART
FN3 517 600 4.81e-4 SMART
transmembrane domain 618 640 N/A INTRINSIC
low complexity region 718 753 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183829
SMART Domains Protein: ENSMUSP00000138987
Gene: ENSMUSG00000021756

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
PDB:1I1R|A 23 52 7e-8 PDB
FN3 56 142 7.23e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184276
SMART Domains Protein: ENSMUSP00000139060
Gene: ENSMUSG00000021756

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Lep_receptor_Ig 24 114 2.3e-33 PFAM
FN3 126 205 1.15e1 SMART
FN3 220 306 7.23e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184311
AA Change: N427D

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000139227
Gene: ENSMUSG00000021756
AA Change: N427D

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Lep_receptor_Ig 24 114 1.2e-32 PFAM
FN3 126 205 1.15e1 SMART
FN3 220 306 7.23e-8 SMART
FN3 324 407 1.07e1 SMART
FN3 422 503 6.1e0 SMART
FN3 517 600 4.81e-4 SMART
transmembrane domain 618 640 N/A INTRINSIC
low complexity region 718 753 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184445
SMART Domains Protein: ENSMUSP00000139311
Gene: ENSMUSG00000021756

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Lep_receptor_Ig 24 114 2e-33 PFAM
FN3 126 205 1.15e1 SMART
FN3 220 306 7.23e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184949
SMART Domains Protein: ENSMUSP00000138915
Gene: ENSMUSG00000021756

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Lep_receptor_Ig 24 114 9.4e-33 PFAM
FN3 126 205 1.15e1 SMART
FN3 220 306 7.23e-8 SMART
FN3 324 442 6.97e0 SMART
FN3 456 539 4.81e-4 SMART
transmembrane domain 557 579 N/A INTRINSIC
low complexity region 657 692 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 97% (72/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a signal transducer shared by many cytokines, including interleukin 6 (IL6), ciliary neurotrophic factor (CNTF), leukemia inhibitory factor (LIF), and oncostatin M (OSM). This protein functions as a part of the cytokine receptor complex. The activation of this protein is dependent upon the binding of cytokines to their receptors. vIL6, a protein related to IL6 and encoded by the Kaposi sarcoma-associated herpesvirus, can bypass the interleukin 6 receptor (IL6R) and directly activate this protein. Knockout studies in mice suggest that this gene plays a critical role in regulating myocyte apoptosis. Alternatively spliced transcript variants have been described. A related pseudogene has been identified on chromosome 17. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygotes for targeted null mutations show myocardial and hematological defects and die between embryonic day 12.5 and term. Conditional mutants show female infertility and neurological, cardiac, hematopoietic, immunological, hepatic, and lung defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik G A 2: 30,796,176 T329I probably damaging Het
Actl6a C A 3: 32,720,224 P290H probably damaging Het
Akap9 T A 5: 4,005,723 probably null Het
Bach1 C T 16: 87,729,663 S671L possibly damaging Het
Cacna1c T C 6: 118,656,249 I1099V Het
Cage1 G T 13: 38,019,244 P615T probably benign Het
Caskin2 C A 11: 115,801,376 R861L probably damaging Het
Cc2d2b A G 19: 40,774,437 T386A unknown Het
Ccndbp1 A G 2: 121,012,943 D272G probably damaging Het
Cep192 T A 18: 67,850,528 V1553E probably damaging Het
Chrm5 C T 2: 112,480,327 G148D probably damaging Het
Cntnap4 T C 8: 112,881,800 V1284A probably benign Het
Cpd T C 11: 76,814,841 Y355C probably damaging Het
Csmd3 C T 15: 47,704,237 V1266I Het
Cyfip2 T C 11: 46,254,666 E609G probably benign Het
Dbr1 T C 9: 99,576,702 probably null Het
Dmxl1 T C 18: 49,955,853 Y2800H probably damaging Het
Dnajc6 G T 4: 101,597,803 A64S probably benign Het
Dpp8 A T 9: 65,045,786 N248I possibly damaging Het
Dsp A T 13: 38,195,593 I2105F probably benign Het
Edem1 G A 6: 108,829,004 V89M probably benign Het
Eml4 A G 17: 83,454,461 Q528R probably benign Het
Epb42 A T 2: 121,024,097 V669D unknown Het
Fat4 A T 3: 38,980,464 Q2755L probably benign Het
Gata6 A G 18: 11,054,475 K135E possibly damaging Het
Gm36079 T A 13: 120,026,705 K103* probably null Het
Gm4788 T A 1: 139,739,295 H414L probably damaging Het
Gmeb1 A T 4: 132,227,890 F325I probably benign Het
H2-M10.3 C T 17: 36,366,559 E276K probably damaging Het
Hist1h4m A T 13: 21,812,057 K92* probably null Het
Ifi207 T C 1: 173,729,018 N718S not run Het
Kat7 T A 11: 95,275,830 M509L probably benign Het
Klk1b4 T C 7: 44,209,621 V21A probably benign Het
Malt1 T A 18: 65,437,827 L78Q probably benign Het
Mertk A G 2: 128,793,108 probably null Het
Myo1b A G 1: 51,757,217 L1016P probably damaging Het
Neu4 A G 1: 94,025,141 I411V probably benign Het
Nutm2 A T 13: 50,473,069 D420V probably damaging Het
Olfr1364 A G 13: 21,574,369 L29P probably damaging Het
Olfr1404 T A 1: 173,216,008 M119K probably damaging Het
Olfr206 T C 16: 59,345,179 D174G probably benign Het
Olfr728 T C 14: 50,140,120 E173G possibly damaging Het
Pcdha12 C T 18: 37,020,263 R12W probably benign Het
Pdgfra G T 5: 75,183,106 D763Y probably damaging Het
Pkd2 T C 5: 104,486,657 V518A probably benign Het
Prb1 G T 6: 132,207,372 P433T unknown Het
Ptrh2 A G 11: 86,690,009 T151A probably damaging Het
Qars T A 9: 108,511,561 N273K probably damaging Het
Robo2 T C 16: 73,920,750 Y1154C probably benign Het
Rps6kc1 T A 1: 190,800,359 D482V probably damaging Het
Sec16b T C 1: 157,529,443 S74P probably benign Het
Serpinb2 A T 1: 107,524,576 I295F probably damaging Het
Sh3pxd2b T A 11: 32,414,318 D301E probably damaging Het
Sipa1l2 G A 8: 125,422,609 T1637I probably benign Het
Slc27a4 A T 2: 29,805,929 N159Y probably damaging Het
Stat1 A C 1: 52,135,621 K161Q possibly damaging Het
Stc2 T C 11: 31,369,872 probably benign Het
Strip1 A G 3: 107,615,335 W681R possibly damaging Het
Sv2a G A 3: 96,193,746 G687S probably damaging Het
Thnsl2 C T 6: 71,139,755 V138I probably benign Het
Tmco3 G A 8: 13,319,605 probably null Het
Tnfrsf1a T C 6: 125,361,596 S235P unknown Het
Tpbg T A 9: 85,844,032 L18* probably null Het
Trabd2b A T 4: 114,610,020 Q482L possibly damaging Het
Trim35 T A 14: 66,297,446 F126Y probably damaging Het
Ttn A T 2: 76,827,944 V12364D unknown Het
Ubac2 A G 14: 121,973,716 Y166C probably damaging Het
Unc13b T A 4: 43,258,519 V1320D probably damaging Het
Usp34 T A 11: 23,460,571 Y2693N Het
Utp20 A T 10: 88,772,459 M1572K probably benign Het
Vmn1r7 C T 6: 57,024,467 M269I probably benign Het
Vmn2r3 C T 3: 64,259,943 G589D probably benign Het
Vrtn A T 12: 84,648,862 M129L probably damaging Het
Zfp273 A T 13: 67,825,064 T104S possibly damaging Het
Zfp384 T A 6: 125,033,312 N390K probably damaging Het
Znfx1 A G 2: 167,042,190 M933T probably benign Het
Other mutations in Il6st
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Il6st APN 13 112481433 unclassified probably null
IGL00571:Il6st APN 13 112487860 missense probably damaging 1.00
IGL01151:Il6st APN 13 112493651 missense probably benign 0.00
IGL01336:Il6st APN 13 112480239 missense possibly damaging 0.71
IGL01501:Il6st APN 13 112480059 missense probably benign 0.22
IGL01512:Il6st APN 13 112504366 missense probably benign 0.36
IGL01657:Il6st APN 13 112481543 missense probably damaging 1.00
IGL01863:Il6st APN 13 112504210 missense possibly damaging 0.88
IGL01916:Il6st APN 13 112480072 missense possibly damaging 0.90
IGL01978:Il6st APN 13 112497357 missense possibly damaging 0.51
IGL02089:Il6st APN 13 112495240 missense probably benign 0.12
IGL02752:Il6st APN 13 112480195 missense probably damaging 0.98
IGL02988:Il6st UTSW 13 112498886 missense probably damaging 1.00
R0019:Il6st UTSW 13 112501148 missense possibly damaging 0.94
R0550:Il6st UTSW 13 112475114 splice site probably null
R0606:Il6st UTSW 13 112504272 missense possibly damaging 0.78
R1126:Il6st UTSW 13 112503732 missense probably damaging 1.00
R1452:Il6st UTSW 13 112481464 missense possibly damaging 0.79
R1581:Il6st UTSW 13 112481541 missense probably damaging 0.99
R1632:Il6st UTSW 13 112504332 missense possibly damaging 0.86
R1881:Il6st UTSW 13 112504413 missense probably damaging 1.00
R2013:Il6st UTSW 13 112498889 missense probably null 0.94
R2043:Il6st UTSW 13 112480219 missense probably benign 0.00
R2128:Il6st UTSW 13 112504175 missense probably benign 0.01
R2137:Il6st UTSW 13 112502858 missense possibly damaging 0.92
R3433:Il6st UTSW 13 112503831 missense probably damaging 1.00
R3696:Il6st UTSW 13 112504382 missense probably benign 0.13
R3697:Il6st UTSW 13 112504382 missense probably benign 0.13
R3698:Il6st UTSW 13 112504382 missense probably benign 0.13
R4172:Il6st UTSW 13 112495327 missense probably benign 0.25
R4543:Il6st UTSW 13 112481459 missense probably damaging 1.00
R4641:Il6st UTSW 13 112488530 missense probably damaging 1.00
R4838:Il6st UTSW 13 112490510 nonsense probably null
R4899:Il6st UTSW 13 112501161 missense probably damaging 1.00
R4922:Il6st UTSW 13 112502865 missense probably damaging 0.98
R5088:Il6st UTSW 13 112490555 missense probably damaging 1.00
R5104:Il6st UTSW 13 112488648 missense probably benign 0.02
R5853:Il6st UTSW 13 112481537 missense probably damaging 1.00
R6602:Il6st UTSW 13 112504413 missense probably damaging 1.00
R7082:Il6st UTSW 13 112504032 missense probably damaging 1.00
R7101:Il6st UTSW 13 112495373 critical splice donor site probably null
R7273:Il6st UTSW 13 112495298 missense probably benign 0.37
R7330:Il6st UTSW 13 112493651 missense probably benign 0.00
R7427:Il6st UTSW 13 112488560 missense probably benign 0.01
U24488:Il6st UTSW 13 112494634 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TTGAACTTTGCAGCTAGTTTGC -3'
(R):5'- AGGTGTACCTCTCAAGTGGG -3'

Sequencing Primer
(F):5'- ACTTTGCAGCTAGTTTGCTAATTTC -3'
(R):5'- TCAAGTGGGTCCGATTCAC -3'
Posted On2019-06-26