Incidental Mutation 'R7192:Olfr728'
ID559681
Institutional Source Beutler Lab
Gene Symbol Olfr728
Ensembl Gene ENSMUSG00000050030
Gene Nameolfactory receptor 728
SynonymsMOR246-1P, GA_x6K02T2PMLR-5831021-5830086
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.217) question?
Stock #R7192 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location50133758-50142680 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 50140120 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 173 (E173G)
Ref Sequence ENSEMBL: ENSMUSP00000149796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051563] [ENSMUST00000213163] [ENSMUST00000213685] [ENSMUST00000215327] [ENSMUST00000215451]
Predicted Effect possibly damaging
Transcript: ENSMUST00000051563
AA Change: E173G

PolyPhen 2 Score 0.476 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000052079
Gene: ENSMUSG00000050030
AA Change: E173G

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 9.8e-43 PFAM
Pfam:7TM_GPCR_Srx 31 304 9.8e-7 PFAM
Pfam:7TM_GPCR_Srsx 35 297 6.5e-9 PFAM
Pfam:7tm_1 41 287 1e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213163
Predicted Effect possibly damaging
Transcript: ENSMUST00000213685
AA Change: E173G

PolyPhen 2 Score 0.476 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000215327
Predicted Effect probably benign
Transcript: ENSMUST00000215451
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik G A 2: 30,796,176 T329I probably damaging Het
Actl6a C A 3: 32,720,224 P290H probably damaging Het
Bach1 C T 16: 87,729,663 S671L possibly damaging Het
Cacna1c T C 6: 118,656,249 I1099V Het
Cage1 G T 13: 38,019,244 P615T probably benign Het
Caskin2 C A 11: 115,801,376 R861L probably damaging Het
Cc2d2b A G 19: 40,774,437 T386A unknown Het
Ccndbp1 A G 2: 121,012,943 D272G probably damaging Het
Cep192 T A 18: 67,850,528 V1553E probably damaging Het
Chrm5 C T 2: 112,480,327 G148D probably damaging Het
Cntnap4 T C 8: 112,881,800 V1284A probably benign Het
Cpd T C 11: 76,814,841 Y355C probably damaging Het
Csmd3 C T 15: 47,704,237 V1266I Het
Cyfip2 T C 11: 46,254,666 E609G probably benign Het
Dbr1 T C 9: 99,576,702 probably null Het
Dmxl1 T C 18: 49,955,853 Y2800H probably damaging Het
Dnajc6 G T 4: 101,597,803 A64S probably benign Het
Dpp8 A T 9: 65,045,786 N248I possibly damaging Het
Dsp A T 13: 38,195,593 I2105F probably benign Het
Edem1 G A 6: 108,829,004 V89M probably benign Het
Eml4 A G 17: 83,454,461 Q528R probably benign Het
Epb42 A T 2: 121,024,097 V669D unknown Het
Fat4 A T 3: 38,980,464 Q2755L probably benign Het
Gata6 A G 18: 11,054,475 K135E possibly damaging Het
Gm36079 T A 13: 120,026,705 K103* probably null Het
Gm4788 T A 1: 139,739,295 H414L probably damaging Het
Gmeb1 A T 4: 132,227,890 F325I probably benign Het
H2-M10.3 C T 17: 36,366,559 E276K probably damaging Het
Hist1h4m A T 13: 21,812,057 K92* probably null Het
Ifi207 T C 1: 173,729,018 N718S not run Het
Il6st A G 13: 112,495,207 N427D probably benign Het
Kat7 T A 11: 95,275,830 M509L probably benign Het
Klk1b4 T C 7: 44,209,621 V21A probably benign Het
Malt1 T A 18: 65,437,827 L78Q probably benign Het
Myo1b A G 1: 51,757,217 L1016P probably damaging Het
Neu4 A G 1: 94,025,141 I411V probably benign Het
Nutm2 A T 13: 50,473,069 D420V probably damaging Het
Olfr1364 A G 13: 21,574,369 L29P probably damaging Het
Olfr1404 T A 1: 173,216,008 M119K probably damaging Het
Olfr206 T C 16: 59,345,179 D174G probably benign Het
Pcdha12 C T 18: 37,020,263 R12W probably benign Het
Pdgfra G T 5: 75,183,106 D763Y probably damaging Het
Pkd2 T C 5: 104,486,657 V518A probably benign Het
Prb1 G T 6: 132,207,372 P433T unknown Het
Ptrh2 A G 11: 86,690,009 T151A probably damaging Het
Qars T A 9: 108,511,561 N273K probably damaging Het
Robo2 T C 16: 73,920,750 Y1154C probably benign Het
Rps6kc1 T A 1: 190,800,359 D482V probably damaging Het
Sec16b T C 1: 157,529,443 S74P probably benign Het
Serpinb2 A T 1: 107,524,576 I295F probably damaging Het
Sh3pxd2b T A 11: 32,414,318 D301E probably damaging Het
Sipa1l2 G A 8: 125,422,609 T1637I probably benign Het
Slc27a4 A T 2: 29,805,929 N159Y probably damaging Het
Stat1 A C 1: 52,135,621 K161Q possibly damaging Het
Stc2 T C 11: 31,369,872 probably benign Het
Strip1 A G 3: 107,615,335 W681R possibly damaging Het
Sv2a G A 3: 96,193,746 G687S probably damaging Het
Thnsl2 C T 6: 71,139,755 V138I probably benign Het
Tnfrsf1a T C 6: 125,361,596 S235P unknown Het
Tpbg T A 9: 85,844,032 L18* probably null Het
Trabd2b A T 4: 114,610,020 Q482L possibly damaging Het
Trim35 T A 14: 66,297,446 F126Y probably damaging Het
Ttn A T 2: 76,827,944 V12364D unknown Het
Ubac2 A G 14: 121,973,716 Y166C probably damaging Het
Unc13b T A 4: 43,258,519 V1320D probably damaging Het
Usp34 T A 11: 23,460,571 Y2693N Het
Utp20 A T 10: 88,772,459 M1572K probably benign Het
Vmn1r7 C T 6: 57,024,467 M269I probably benign Het
Vmn2r3 C T 3: 64,259,943 G589D probably benign Het
Vrtn A T 12: 84,648,862 M129L probably damaging Het
Zfp273 A T 13: 67,825,064 T104S possibly damaging Het
Zfp384 T A 6: 125,033,312 N390K probably damaging Het
Znfx1 A G 2: 167,042,190 M933T probably benign Het
Other mutations in Olfr728
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01101:Olfr728 APN 14 50140054 missense probably benign 0.06
IGL02080:Olfr728 APN 14 50140122 missense probably damaging 1.00
IGL03187:Olfr728 APN 14 50139800 missense probably damaging 0.98
R1613:Olfr728 UTSW 14 50140294 missense probably damaging 1.00
R1671:Olfr728 UTSW 14 50139833 missense probably damaging 1.00
R1876:Olfr728 UTSW 14 50140172 missense probably damaging 0.99
R2085:Olfr728 UTSW 14 50140123 missense probably damaging 1.00
R2086:Olfr728 UTSW 14 50140123 missense probably damaging 1.00
R2158:Olfr728 UTSW 14 50140123 missense probably damaging 1.00
R2226:Olfr728 UTSW 14 50140619 missense probably damaging 1.00
R2516:Olfr728 UTSW 14 50139983 missense probably benign
R4454:Olfr728 UTSW 14 50140496 missense probably benign 0.00
R4714:Olfr728 UTSW 14 50139979 missense possibly damaging 0.55
R4754:Olfr728 UTSW 14 50140033 missense possibly damaging 0.90
R4754:Olfr728 UTSW 14 50140034 missense probably benign 0.02
R5275:Olfr728 UTSW 14 50140496 missense probably benign 0.35
R5339:Olfr728 UTSW 14 50140302 missense probably damaging 0.96
R6614:Olfr728 UTSW 14 50140364 missense probably damaging 1.00
R6713:Olfr728 UTSW 14 50139724 missense probably benign
R6900:Olfr728 UTSW 14 50139838 missense possibly damaging 0.94
R7062:Olfr728 UTSW 14 50140450 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGGCTTTGGATGACCCAC -3'
(R):5'- GAGGGTTGTATGGCTCAAATATTTC -3'

Sequencing Primer
(F):5'- CTTTGGATGACCCACTAGAGGACTG -3'
(R):5'- AGTGAAATGATGTTGCTTGTAGC -3'
Posted On2019-06-26