Incidental Mutation 'R7192:Trim35'
ID559682
Institutional Source Beutler Lab
Gene Symbol Trim35
Ensembl Gene ENSMUSG00000022043
Gene Nametripartite motif-containing 35
SynonymsHls5, Mair, A430106H13Rik, 0710005M05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R7192 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location66297031-66311424 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 66297446 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 126 (F126Y)
Ref Sequence ENSEMBL: ENSMUSP00000022623 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022623]
Predicted Effect probably damaging
Transcript: ENSMUST00000022623
AA Change: F126Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022623
Gene: ENSMUSG00000022043
AA Change: F126Y

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
low complexity region 18 29 N/A INTRINSIC
RING 36 75 6.89e-8 SMART
BBOX 111 152 1.27e-6 SMART
coiled coil region 219 267 N/A INTRINSIC
PRY 316 367 4.41e-15 SMART
Pfam:SPRY 370 495 3.5e-11 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000112877
Gene: ENSMUSG00000022043
AA Change: F119Y

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
RING 30 69 6.89e-8 SMART
BBOX 105 146 1.27e-6 SMART
coiled coil region 212 260 N/A INTRINSIC
low complexity region 330 343 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 97% (72/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The function of this protein has not been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik G A 2: 30,796,176 T329I probably damaging Het
Actl6a C A 3: 32,720,224 P290H probably damaging Het
Akap9 T A 5: 4,005,723 probably null Het
Bach1 C T 16: 87,729,663 S671L possibly damaging Het
Cacna1c T C 6: 118,656,249 I1099V Het
Cage1 G T 13: 38,019,244 P615T probably benign Het
Caskin2 C A 11: 115,801,376 R861L probably damaging Het
Cc2d2b A G 19: 40,774,437 T386A unknown Het
Ccndbp1 A G 2: 121,012,943 D272G probably damaging Het
Cep192 T A 18: 67,850,528 V1553E probably damaging Het
Chrm5 C T 2: 112,480,327 G148D probably damaging Het
Cntnap4 T C 8: 112,881,800 V1284A probably benign Het
Cpd T C 11: 76,814,841 Y355C probably damaging Het
Csmd3 C T 15: 47,704,237 V1266I Het
Cyfip2 T C 11: 46,254,666 E609G probably benign Het
Dbr1 T C 9: 99,576,702 probably null Het
Dmxl1 T C 18: 49,955,853 Y2800H probably damaging Het
Dnajc6 G T 4: 101,597,803 A64S probably benign Het
Dpp8 A T 9: 65,045,786 N248I possibly damaging Het
Dsp A T 13: 38,195,593 I2105F probably benign Het
Edem1 G A 6: 108,829,004 V89M probably benign Het
Eml4 A G 17: 83,454,461 Q528R probably benign Het
Epb42 A T 2: 121,024,097 V669D unknown Het
Fat4 A T 3: 38,980,464 Q2755L probably benign Het
Gata6 A G 18: 11,054,475 K135E possibly damaging Het
Gm36079 T A 13: 120,026,705 K103* probably null Het
Gm4788 T A 1: 139,739,295 H414L probably damaging Het
Gmeb1 A T 4: 132,227,890 F325I probably benign Het
H2-M10.3 C T 17: 36,366,559 E276K probably damaging Het
Hist1h4m A T 13: 21,812,057 K92* probably null Het
Ifi207 T C 1: 173,729,018 N718S not run Het
Il6st A G 13: 112,495,207 N427D probably benign Het
Kat7 T A 11: 95,275,830 M509L probably benign Het
Klk1b4 T C 7: 44,209,621 V21A probably benign Het
Malt1 T A 18: 65,437,827 L78Q probably benign Het
Mertk A G 2: 128,793,108 probably null Het
Myo1b A G 1: 51,757,217 L1016P probably damaging Het
Neu4 A G 1: 94,025,141 I411V probably benign Het
Nutm2 A T 13: 50,473,069 D420V probably damaging Het
Olfr1364 A G 13: 21,574,369 L29P probably damaging Het
Olfr1404 T A 1: 173,216,008 M119K probably damaging Het
Olfr206 T C 16: 59,345,179 D174G probably benign Het
Olfr728 T C 14: 50,140,120 E173G possibly damaging Het
Pcdha12 C T 18: 37,020,263 R12W probably benign Het
Pdgfra G T 5: 75,183,106 D763Y probably damaging Het
Pkd2 T C 5: 104,486,657 V518A probably benign Het
Prb1 G T 6: 132,207,372 P433T unknown Het
Ptrh2 A G 11: 86,690,009 T151A probably damaging Het
Qars T A 9: 108,511,561 N273K probably damaging Het
Robo2 T C 16: 73,920,750 Y1154C probably benign Het
Rps6kc1 T A 1: 190,800,359 D482V probably damaging Het
Sec16b T C 1: 157,529,443 S74P probably benign Het
Serpinb2 A T 1: 107,524,576 I295F probably damaging Het
Sh3pxd2b T A 11: 32,414,318 D301E probably damaging Het
Sipa1l2 G A 8: 125,422,609 T1637I probably benign Het
Slc27a4 A T 2: 29,805,929 N159Y probably damaging Het
Stat1 A C 1: 52,135,621 K161Q possibly damaging Het
Stc2 T C 11: 31,369,872 probably benign Het
Strip1 A G 3: 107,615,335 W681R possibly damaging Het
Sv2a G A 3: 96,193,746 G687S probably damaging Het
Thnsl2 C T 6: 71,139,755 V138I probably benign Het
Tmco3 G A 8: 13,319,605 probably null Het
Tnfrsf1a T C 6: 125,361,596 S235P unknown Het
Tpbg T A 9: 85,844,032 L18* probably null Het
Trabd2b A T 4: 114,610,020 Q482L possibly damaging Het
Ttn A T 2: 76,827,944 V12364D unknown Het
Ubac2 A G 14: 121,973,716 Y166C probably damaging Het
Unc13b T A 4: 43,258,519 V1320D probably damaging Het
Usp34 T A 11: 23,460,571 Y2693N Het
Utp20 A T 10: 88,772,459 M1572K probably benign Het
Vmn1r7 C T 6: 57,024,467 M269I probably benign Het
Vmn2r3 C T 3: 64,259,943 G589D probably benign Het
Vrtn A T 12: 84,648,862 M129L probably damaging Het
Zfp273 A T 13: 67,825,064 T104S possibly damaging Het
Zfp384 T A 6: 125,033,312 N390K probably damaging Het
Znfx1 A G 2: 167,042,190 M933T probably benign Het
Other mutations in Trim35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01652:Trim35 APN 14 66308801 missense probably damaging 1.00
IGL02398:Trim35 APN 14 66309248 missense probably damaging 1.00
IGL03132:Trim35 APN 14 66309146 missense probably damaging 1.00
R0759:Trim35 UTSW 14 66308787 missense probably benign 0.02
R0799:Trim35 UTSW 14 66309201 missense probably damaging 1.00
R0848:Trim35 UTSW 14 66309125 missense probably benign 0.01
R1170:Trim35 UTSW 14 66308799 missense probably benign 0.35
R1734:Trim35 UTSW 14 66309329 missense probably damaging 0.99
R1751:Trim35 UTSW 14 66304168 missense probably damaging 0.97
R1767:Trim35 UTSW 14 66304168 missense probably damaging 0.97
R2259:Trim35 UTSW 14 66309262 nonsense probably null
R3963:Trim35 UTSW 14 66304054 missense probably damaging 1.00
R4572:Trim35 UTSW 14 66307873 missense probably damaging 1.00
R5068:Trim35 UTSW 14 66308972 unclassified probably benign
R5069:Trim35 UTSW 14 66308972 unclassified probably benign
R5070:Trim35 UTSW 14 66308972 unclassified probably benign
R5372:Trim35 UTSW 14 66297266 missense possibly damaging 0.69
R5886:Trim35 UTSW 14 66304053 missense possibly damaging 0.92
R5886:Trim35 UTSW 14 66304054 missense probably damaging 1.00
R6018:Trim35 UTSW 14 66308750 missense probably damaging 1.00
R6165:Trim35 UTSW 14 66309205 missense probably damaging 1.00
R6326:Trim35 UTSW 14 66303204 missense possibly damaging 0.52
R6476:Trim35 UTSW 14 66308795 missense probably damaging 1.00
R7084:Trim35 UTSW 14 66308822 missense probably damaging 0.98
R7350:Trim35 UTSW 14 66309205 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAAGAGGAGCTGCTGTGTG -3'
(R):5'- AAGATGGTTGCTAGGCCTG -3'

Sequencing Primer
(F):5'- AGTAACTCTGCGCTGTGGC -3'
(R):5'- TGCTAGGCCTGGAGGAG -3'
Posted On2019-06-26