Incidental Mutation 'R7192:Dmxl1'
ID559692
Institutional Source Beutler Lab
Gene Symbol Dmxl1
Ensembl Gene ENSMUSG00000037416
Gene NameDmx-like 1
SynonymsC630007L23Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.951) question?
Stock #R7192 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location49832670-49965473 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 49955853 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 2800 (Y2800H)
Ref Sequence ENSEMBL: ENSMUSP00000137871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041772] [ENSMUST00000180611]
Predicted Effect probably damaging
Transcript: ENSMUST00000041772
AA Change: Y2812H

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000045559
Gene: ENSMUSG00000037416
AA Change: Y2812H

DomainStartEndE-ValueType
WD40 100 136 8.22e1 SMART
WD40 156 195 2.88e-1 SMART
WD40 218 266 8.29e-1 SMART
low complexity region 367 378 N/A INTRINSIC
WD40 464 505 1.53e2 SMART
Blast:WD40 719 772 1e-25 BLAST
WD40 957 999 1.1e1 SMART
Pfam:Rav1p_C 1102 1877 4.3e-84 PFAM
low complexity region 1922 1942 N/A INTRINSIC
low complexity region 1966 1975 N/A INTRINSIC
low complexity region 1993 2007 N/A INTRINSIC
low complexity region 2147 2158 N/A INTRINSIC
low complexity region 2371 2385 N/A INTRINSIC
low complexity region 2397 2410 N/A INTRINSIC
low complexity region 2449 2466 N/A INTRINSIC
WD40 2735 2770 1.07e1 SMART
WD40 2773 2813 3.7e0 SMART
WD40 2825 2867 1.07e0 SMART
WD40 2873 2912 1.05e-2 SMART
WD40 2915 2954 4.51e-7 SMART
Blast:WD40 2957 3005 9e-26 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000180611
AA Change: Y2800H

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000137871
Gene: ENSMUSG00000037416
AA Change: Y2800H

DomainStartEndE-ValueType
WD40 100 136 8.22e1 SMART
WD40 156 195 2.88e-1 SMART
WD40 218 266 8.29e-1 SMART
low complexity region 367 378 N/A INTRINSIC
WD40 464 505 1.53e2 SMART
Blast:WD40 719 772 1e-25 BLAST
WD40 957 999 1.1e1 SMART
low complexity region 1195 1206 N/A INTRINSIC
low complexity region 1258 1271 N/A INTRINSIC
Pfam:Rav1p_C 1287 1876 9.4e-72 PFAM
low complexity region 1922 1942 N/A INTRINSIC
low complexity region 1966 1975 N/A INTRINSIC
low complexity region 1993 2007 N/A INTRINSIC
low complexity region 2147 2158 N/A INTRINSIC
low complexity region 2385 2398 N/A INTRINSIC
low complexity region 2437 2454 N/A INTRINSIC
WD40 2723 2758 1.07e1 SMART
WD40 2761 2801 3.7e0 SMART
WD40 2813 2855 1.07e0 SMART
WD40 2861 2900 1.05e-2 SMART
WD40 2903 2942 4.51e-7 SMART
Blast:WD40 2945 2993 9e-26 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the WD repeat superfamily of proteins, which have regulatory functions. This gene is expressed in many tissue types including several types of eye tissue, and it has been associated with ocular phenotypes. In addition, it is upregulated in cultured cells that overexpress growth factor independence 1B, a transcription factor that is essential for hematopoietic cell development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik G A 2: 30,796,176 T329I probably damaging Het
Actl6a C A 3: 32,720,224 P290H probably damaging Het
Bach1 C T 16: 87,729,663 S671L possibly damaging Het
Cacna1c T C 6: 118,656,249 I1099V Het
Cage1 G T 13: 38,019,244 P615T probably benign Het
Caskin2 C A 11: 115,801,376 R861L probably damaging Het
Cc2d2b A G 19: 40,774,437 T386A unknown Het
Ccndbp1 A G 2: 121,012,943 D272G probably damaging Het
Cep192 T A 18: 67,850,528 V1553E probably damaging Het
Chrm5 C T 2: 112,480,327 G148D probably damaging Het
Cntnap4 T C 8: 112,881,800 V1284A probably benign Het
Cpd T C 11: 76,814,841 Y355C probably damaging Het
Csmd3 C T 15: 47,704,237 V1266I Het
Cyfip2 T C 11: 46,254,666 E609G probably benign Het
Dbr1 T C 9: 99,576,702 probably null Het
Dnajc6 G T 4: 101,597,803 A64S probably benign Het
Dpp8 A T 9: 65,045,786 N248I possibly damaging Het
Dsp A T 13: 38,195,593 I2105F probably benign Het
Edem1 G A 6: 108,829,004 V89M probably benign Het
Eml4 A G 17: 83,454,461 Q528R probably benign Het
Epb42 A T 2: 121,024,097 V669D unknown Het
Fat4 A T 3: 38,980,464 Q2755L probably benign Het
Gata6 A G 18: 11,054,475 K135E possibly damaging Het
Gm36079 T A 13: 120,026,705 K103* probably null Het
Gm4788 T A 1: 139,739,295 H414L probably damaging Het
Gmeb1 A T 4: 132,227,890 F325I probably benign Het
H2-M10.3 C T 17: 36,366,559 E276K probably damaging Het
Hist1h4m A T 13: 21,812,057 K92* probably null Het
Ifi207 T C 1: 173,729,018 N718S not run Het
Il6st A G 13: 112,495,207 N427D probably benign Het
Kat7 T A 11: 95,275,830 M509L probably benign Het
Klk1b4 T C 7: 44,209,621 V21A probably benign Het
Malt1 T A 18: 65,437,827 L78Q probably benign Het
Myo1b A G 1: 51,757,217 L1016P probably damaging Het
Neu4 A G 1: 94,025,141 I411V probably benign Het
Nutm2 A T 13: 50,473,069 D420V probably damaging Het
Olfr1364 A G 13: 21,574,369 L29P probably damaging Het
Olfr1404 T A 1: 173,216,008 M119K probably damaging Het
Olfr206 T C 16: 59,345,179 D174G probably benign Het
Olfr728 T C 14: 50,140,120 E173G possibly damaging Het
Pcdha12 C T 18: 37,020,263 R12W probably benign Het
Pdgfra G T 5: 75,183,106 D763Y probably damaging Het
Pkd2 T C 5: 104,486,657 V518A probably benign Het
Prb1 G T 6: 132,207,372 P433T unknown Het
Ptrh2 A G 11: 86,690,009 T151A probably damaging Het
Qars T A 9: 108,511,561 N273K probably damaging Het
Robo2 T C 16: 73,920,750 Y1154C probably benign Het
Rps6kc1 T A 1: 190,800,359 D482V probably damaging Het
Sec16b T C 1: 157,529,443 S74P probably benign Het
Serpinb2 A T 1: 107,524,576 I295F probably damaging Het
Sh3pxd2b T A 11: 32,414,318 D301E probably damaging Het
Sipa1l2 G A 8: 125,422,609 T1637I probably benign Het
Slc27a4 A T 2: 29,805,929 N159Y probably damaging Het
Stat1 A C 1: 52,135,621 K161Q possibly damaging Het
Stc2 T C 11: 31,369,872 probably benign Het
Strip1 A G 3: 107,615,335 W681R possibly damaging Het
Sv2a G A 3: 96,193,746 G687S probably damaging Het
Thnsl2 C T 6: 71,139,755 V138I probably benign Het
Tnfrsf1a T C 6: 125,361,596 S235P unknown Het
Tpbg T A 9: 85,844,032 L18* probably null Het
Trabd2b A T 4: 114,610,020 Q482L possibly damaging Het
Trim35 T A 14: 66,297,446 F126Y probably damaging Het
Ttn A T 2: 76,827,944 V12364D unknown Het
Ubac2 A G 14: 121,973,716 Y166C probably damaging Het
Unc13b T A 4: 43,258,519 V1320D probably damaging Het
Usp34 T A 11: 23,460,571 Y2693N Het
Utp20 A T 10: 88,772,459 M1572K probably benign Het
Vmn1r7 C T 6: 57,024,467 M269I probably benign Het
Vmn2r3 C T 3: 64,259,943 G589D probably benign Het
Vrtn A T 12: 84,648,862 M129L probably damaging Het
Zfp273 A T 13: 67,825,064 T104S possibly damaging Het
Zfp384 T A 6: 125,033,312 N390K probably damaging Het
Znfx1 A G 2: 167,042,190 M933T probably benign Het
Other mutations in Dmxl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Dmxl1 APN 18 49851467 missense probably damaging 1.00
IGL00668:Dmxl1 APN 18 49939553 missense possibly damaging 0.64
IGL00740:Dmxl1 APN 18 49917668 missense probably benign 0.00
IGL00969:Dmxl1 APN 18 49912725 missense probably benign 0.02
IGL01113:Dmxl1 APN 18 49912751 missense probably benign 0.01
IGL01384:Dmxl1 APN 18 49857334 missense probably benign
IGL01475:Dmxl1 APN 18 49871714 missense probably damaging 1.00
IGL01559:Dmxl1 APN 18 49920938 missense probably damaging 0.99
IGL01578:Dmxl1 APN 18 49962205 missense probably damaging 1.00
IGL01632:Dmxl1 APN 18 49863025 missense probably damaging 0.99
IGL01814:Dmxl1 APN 18 49864868 missense probably damaging 1.00
IGL01843:Dmxl1 APN 18 49878382 nonsense probably null
IGL01933:Dmxl1 APN 18 49877785 missense probably benign 0.17
IGL01952:Dmxl1 APN 18 49890654 missense probably benign 0.11
IGL02120:Dmxl1 APN 18 49894178 missense possibly damaging 0.83
IGL02162:Dmxl1 APN 18 49961163 missense probably benign 0.00
IGL02213:Dmxl1 APN 18 49877674 splice site probably benign
IGL02261:Dmxl1 APN 18 49840499 missense possibly damaging 0.85
IGL02689:Dmxl1 APN 18 49864895 missense probably damaging 1.00
IGL02892:Dmxl1 APN 18 49859120 missense probably damaging 0.96
IGL03232:Dmxl1 APN 18 49878180 missense probably benign 0.01
IGL03258:Dmxl1 APN 18 49920893 missense probably damaging 1.00
IGL03298:Dmxl1 APN 18 49864818 missense probably benign
hibiscus UTSW 18 49889467 missense probably damaging 1.00
pitcher UTSW 18 49864148 missense probably damaging 1.00
PIT4810001:Dmxl1 UTSW 18 49931963 missense probably damaging 1.00
R0001:Dmxl1 UTSW 18 49888897 splice site probably benign
R0027:Dmxl1 UTSW 18 49957295 splice site probably benign
R0042:Dmxl1 UTSW 18 49864035 missense probably benign 0.03
R0042:Dmxl1 UTSW 18 49864035 missense probably benign 0.03
R0046:Dmxl1 UTSW 18 49878082 missense probably benign 0.22
R0046:Dmxl1 UTSW 18 49878082 missense probably benign 0.22
R0257:Dmxl1 UTSW 18 49955803 splice site probably benign
R0349:Dmxl1 UTSW 18 49879282 missense probably damaging 0.99
R0390:Dmxl1 UTSW 18 49879362 missense probably benign 0.14
R0511:Dmxl1 UTSW 18 49891467 nonsense probably null
R0539:Dmxl1 UTSW 18 49857430 splice site probably benign
R0542:Dmxl1 UTSW 18 49893694 missense probably benign 0.05
R0587:Dmxl1 UTSW 18 49935307 missense probably benign 0.39
R0635:Dmxl1 UTSW 18 49851423 splice site probably benign
R0744:Dmxl1 UTSW 18 49833148 missense probably damaging 1.00
R0836:Dmxl1 UTSW 18 49833148 missense probably damaging 1.00
R0845:Dmxl1 UTSW 18 49893402 missense probably damaging 1.00
R1218:Dmxl1 UTSW 18 49893611 missense probably damaging 1.00
R1278:Dmxl1 UTSW 18 49893225 missense probably benign
R1313:Dmxl1 UTSW 18 49878483 missense probably damaging 1.00
R1313:Dmxl1 UTSW 18 49878483 missense probably damaging 1.00
R1349:Dmxl1 UTSW 18 49888853 missense probably damaging 1.00
R1453:Dmxl1 UTSW 18 49857249 missense probably benign 0.05
R1522:Dmxl1 UTSW 18 49852367 missense probably benign 0.05
R1629:Dmxl1 UTSW 18 49859286 critical splice donor site probably null
R1638:Dmxl1 UTSW 18 49890767 nonsense probably null
R1646:Dmxl1 UTSW 18 49962261 missense probably damaging 1.00
R1719:Dmxl1 UTSW 18 49934637 missense probably damaging 1.00
R1732:Dmxl1 UTSW 18 49893444 nonsense probably null
R1732:Dmxl1 UTSW 18 49902988 missense probably benign
R1886:Dmxl1 UTSW 18 49859135 missense probably benign 0.09
R1887:Dmxl1 UTSW 18 49859135 missense probably benign 0.09
R1895:Dmxl1 UTSW 18 49955914 splice site probably null
R1911:Dmxl1 UTSW 18 49878163 missense probably benign 0.00
R2020:Dmxl1 UTSW 18 49889558 nonsense probably null
R2116:Dmxl1 UTSW 18 49878817 missense probably damaging 1.00
R2196:Dmxl1 UTSW 18 49917631 missense probably benign 0.00
R2206:Dmxl1 UTSW 18 49894094 missense probably benign 0.12
R2216:Dmxl1 UTSW 18 49893923 missense probably benign 0.00
R2255:Dmxl1 UTSW 18 49846639 missense probably benign 0.34
R2333:Dmxl1 UTSW 18 49919976 splice site probably null
R2343:Dmxl1 UTSW 18 49890678 missense probably damaging 1.00
R2496:Dmxl1 UTSW 18 49880791 missense possibly damaging 0.51
R3757:Dmxl1 UTSW 18 49935317 missense probably damaging 0.98
R3758:Dmxl1 UTSW 18 49935317 missense probably damaging 0.98
R3783:Dmxl1 UTSW 18 49865122 missense probably damaging 1.00
R3786:Dmxl1 UTSW 18 49865122 missense probably damaging 1.00
R3787:Dmxl1 UTSW 18 49865122 missense probably damaging 1.00
R3885:Dmxl1 UTSW 18 49878259 missense probably damaging 1.00
R3886:Dmxl1 UTSW 18 49878259 missense probably damaging 1.00
R3887:Dmxl1 UTSW 18 49878259 missense probably damaging 1.00
R3888:Dmxl1 UTSW 18 49878259 missense probably damaging 1.00
R3889:Dmxl1 UTSW 18 49878259 missense probably damaging 1.00
R4014:Dmxl1 UTSW 18 49863962 missense probably benign
R4033:Dmxl1 UTSW 18 49851431 missense possibly damaging 0.95
R4096:Dmxl1 UTSW 18 49961197 missense probably damaging 1.00
R4366:Dmxl1 UTSW 18 49878017 nonsense probably null
R4406:Dmxl1 UTSW 18 49889553 missense probably damaging 1.00
R4412:Dmxl1 UTSW 18 49848761 missense probably benign
R4454:Dmxl1 UTSW 18 49893332 missense probably benign 0.01
R4459:Dmxl1 UTSW 18 49961216 missense possibly damaging 0.80
R4569:Dmxl1 UTSW 18 49852360 missense probably damaging 1.00
R4570:Dmxl1 UTSW 18 49852360 missense probably damaging 1.00
R4606:Dmxl1 UTSW 18 49962181 missense probably damaging 0.98
R4649:Dmxl1 UTSW 18 49878631 missense probably damaging 0.99
R4683:Dmxl1 UTSW 18 49878021 missense probably damaging 1.00
R4782:Dmxl1 UTSW 18 49862992 missense probably damaging 1.00
R4878:Dmxl1 UTSW 18 49851476 missense probably damaging 1.00
R4879:Dmxl1 UTSW 18 49889467 missense probably damaging 1.00
R4881:Dmxl1 UTSW 18 49957281 intron probably benign
R4885:Dmxl1 UTSW 18 49878795 missense probably damaging 0.99
R4916:Dmxl1 UTSW 18 49877697 missense probably damaging 1.00
R5022:Dmxl1 UTSW 18 49895127 missense probably damaging 0.99
R5056:Dmxl1 UTSW 18 49870923 missense probably benign 0.00
R5177:Dmxl1 UTSW 18 49893584 missense probably damaging 0.99
R5342:Dmxl1 UTSW 18 49951235 missense probably damaging 0.96
R5421:Dmxl1 UTSW 18 49863119 critical splice donor site probably null
R5433:Dmxl1 UTSW 18 49867899 splice site probably null
R5484:Dmxl1 UTSW 18 49889464 missense probably damaging 1.00
R5598:Dmxl1 UTSW 18 49864478 missense probably benign 0.04
R5633:Dmxl1 UTSW 18 49877697 missense probably damaging 1.00
R5638:Dmxl1 UTSW 18 49891626 missense possibly damaging 0.95
R5694:Dmxl1 UTSW 18 49894257 missense probably damaging 1.00
R5696:Dmxl1 UTSW 18 49931941 nonsense probably null
R5706:Dmxl1 UTSW 18 49957395 critical splice donor site probably null
R5745:Dmxl1 UTSW 18 49846586 missense probably benign
R5876:Dmxl1 UTSW 18 49870984 missense possibly damaging 0.70
R6054:Dmxl1 UTSW 18 49857386 missense probably benign 0.00
R6145:Dmxl1 UTSW 18 49912766 missense possibly damaging 0.90
R6189:Dmxl1 UTSW 18 49893335 missense probably benign 0.33
R6213:Dmxl1 UTSW 18 49863015 missense possibly damaging 0.93
R6219:Dmxl1 UTSW 18 49902367 missense probably damaging 0.99
R6221:Dmxl1 UTSW 18 49871732 missense probably damaging 0.96
R6276:Dmxl1 UTSW 18 49846586 missense probably benign
R6319:Dmxl1 UTSW 18 49852300 missense probably benign 0.00
R6426:Dmxl1 UTSW 18 49864578 missense probably damaging 0.99
R6567:Dmxl1 UTSW 18 49859179 missense probably damaging 0.99
R6739:Dmxl1 UTSW 18 49878246 missense probably benign 0.03
R6743:Dmxl1 UTSW 18 49880780 missense possibly damaging 0.95
R6776:Dmxl1 UTSW 18 49893974 missense probably damaging 1.00
R6827:Dmxl1 UTSW 18 49921024 missense probably damaging 1.00
R6828:Dmxl1 UTSW 18 49921024 missense probably damaging 1.00
R6829:Dmxl1 UTSW 18 49921024 missense probably damaging 1.00
R6830:Dmxl1 UTSW 18 49921024 missense probably damaging 1.00
R6833:Dmxl1 UTSW 18 49955823 missense probably damaging 0.99
R6834:Dmxl1 UTSW 18 49955823 missense probably damaging 0.99
R6856:Dmxl1 UTSW 18 49852288 nonsense probably null
R6857:Dmxl1 UTSW 18 49864835 missense probably damaging 0.99
R6881:Dmxl1 UTSW 18 49935305 missense probably benign 0.00
R6882:Dmxl1 UTSW 18 49843784 critical splice acceptor site probably null
R6892:Dmxl1 UTSW 18 49920902 missense probably damaging 0.98
R6897:Dmxl1 UTSW 18 49851495 missense probably null 0.99
R6897:Dmxl1 UTSW 18 49863057 missense possibly damaging 0.51
R6917:Dmxl1 UTSW 18 49864148 missense probably damaging 1.00
X0025:Dmxl1 UTSW 18 49864368 missense probably damaging 0.98
X0066:Dmxl1 UTSW 18 49919899 missense probably damaging 1.00
Z1088:Dmxl1 UTSW 18 49920965 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTTGCTACACTGGAAGTCTTC -3'
(R):5'- GGTGCTGTACCCATTAACTTTC -3'

Sequencing Primer
(F):5'- CACTGGAAGTCTTCTTAAAGTGG -3'
(R):5'- ACAGGAGCCTATAATAGCAACTG -3'
Posted On2019-06-26