Incidental Mutation 'R7192:Malt1'
ID559693
Institutional Source Beutler Lab
Gene Symbol Malt1
Ensembl Gene ENSMUSG00000032688
Gene NameMALT1 paracaspase
Synonymsparacaspase, D430033E09Rik
MMRRC Submission
Accession Numbers

Genbank: NM_172833

Is this an essential gene? Possibly non essential (E-score: 0.322) question?
Stock #R7192 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location65430962-65478823 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 65437827 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 78 (L78Q)
Ref Sequence ENSEMBL: ENSMUSP00000048376 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049248] [ENSMUST00000224056]
Predicted Effect probably benign
Transcript: ENSMUST00000049248
AA Change: L78Q

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000048376
Gene: ENSMUSG00000032688
AA Change: L78Q

DomainStartEndE-ValueType
low complexity region 19 35 N/A INTRINSIC
low complexity region 38 51 N/A INTRINSIC
PDB:2G7R|B 52 132 3e-29 PDB
IGc2 145 203 8.19e-9 SMART
IGc2 248 306 2.88e-4 SMART
Pfam:Peptidase_C14 340 557 1.4e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000224056
AA Change: L78Q

PolyPhen 2 Score 0.486 (Sensitivity: 0.88; Specificity: 0.90)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 97% (72/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene has been found to be recurrently rearranged in chromosomal translocation with two other genes - baculoviral IAP repeat-containing protein 3 (also known as apoptosis inhibitor 2) and immunoglobulin heavy chain locus - in mucosa-associated lymphoid tissue lymphomas. The protein encoded by this gene may play a role in NF-kappaB activation. Two alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene disrupts normal B cell development and leads to impaired cytokine production and T cell and B cell proliferative responses after antigen receptor engagement due to failure of NF-kappaB activation. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, knock-out(2) Targeted, other(2) Gene trapped(3)

Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik G A 2: 30,796,176 T329I probably damaging Het
Actl6a C A 3: 32,720,224 P290H probably damaging Het
Akap9 T A 5: 4,005,723 probably null Het
Bach1 C T 16: 87,729,663 S671L possibly damaging Het
Cacna1c T C 6: 118,656,249 I1099V Het
Cage1 G T 13: 38,019,244 P615T probably benign Het
Caskin2 C A 11: 115,801,376 R861L probably damaging Het
Cc2d2b A G 19: 40,774,437 T386A unknown Het
Ccndbp1 A G 2: 121,012,943 D272G probably damaging Het
Cep192 T A 18: 67,850,528 V1553E probably damaging Het
Chrm5 C T 2: 112,480,327 G148D probably damaging Het
Cntnap4 T C 8: 112,881,800 V1284A probably benign Het
Cpd T C 11: 76,814,841 Y355C probably damaging Het
Csmd3 C T 15: 47,704,237 V1266I Het
Cyfip2 T C 11: 46,254,666 E609G probably benign Het
Dbr1 T C 9: 99,576,702 probably null Het
Dmxl1 T C 18: 49,955,853 Y2800H probably damaging Het
Dnajc6 G T 4: 101,597,803 A64S probably benign Het
Dpp8 A T 9: 65,045,786 N248I possibly damaging Het
Dsp A T 13: 38,195,593 I2105F probably benign Het
Edem1 G A 6: 108,829,004 V89M probably benign Het
Eml4 A G 17: 83,454,461 Q528R probably benign Het
Epb42 A T 2: 121,024,097 V669D unknown Het
Fat4 A T 3: 38,980,464 Q2755L probably benign Het
Gata6 A G 18: 11,054,475 K135E possibly damaging Het
Gm36079 T A 13: 120,026,705 K103* probably null Het
Gm4788 T A 1: 139,739,295 H414L probably damaging Het
Gmeb1 A T 4: 132,227,890 F325I probably benign Het
H2-M10.3 C T 17: 36,366,559 E276K probably damaging Het
Hist1h4m A T 13: 21,812,057 K92* probably null Het
Ifi207 T C 1: 173,729,018 N718S not run Het
Il6st A G 13: 112,495,207 N427D probably benign Het
Kat7 T A 11: 95,275,830 M509L probably benign Het
Klk1b4 T C 7: 44,209,621 V21A probably benign Het
Mertk A G 2: 128,793,108 probably null Het
Myo1b A G 1: 51,757,217 L1016P probably damaging Het
Neu4 A G 1: 94,025,141 I411V probably benign Het
Nutm2 A T 13: 50,473,069 D420V probably damaging Het
Olfr1364 A G 13: 21,574,369 L29P probably damaging Het
Olfr1404 T A 1: 173,216,008 M119K probably damaging Het
Olfr206 T C 16: 59,345,179 D174G probably benign Het
Olfr728 T C 14: 50,140,120 E173G possibly damaging Het
Pcdha12 C T 18: 37,020,263 R12W probably benign Het
Pdgfra G T 5: 75,183,106 D763Y probably damaging Het
Pkd2 T C 5: 104,486,657 V518A probably benign Het
Prb1 G T 6: 132,207,372 P433T unknown Het
Ptrh2 A G 11: 86,690,009 T151A probably damaging Het
Qars T A 9: 108,511,561 N273K probably damaging Het
Robo2 T C 16: 73,920,750 Y1154C probably benign Het
Rps6kc1 T A 1: 190,800,359 D482V probably damaging Het
Sec16b T C 1: 157,529,443 S74P probably benign Het
Serpinb2 A T 1: 107,524,576 I295F probably damaging Het
Sh3pxd2b T A 11: 32,414,318 D301E probably damaging Het
Sipa1l2 G A 8: 125,422,609 T1637I probably benign Het
Slc27a4 A T 2: 29,805,929 N159Y probably damaging Het
Stat1 A C 1: 52,135,621 K161Q possibly damaging Het
Stc2 T C 11: 31,369,872 probably benign Het
Strip1 A G 3: 107,615,335 W681R possibly damaging Het
Sv2a G A 3: 96,193,746 G687S probably damaging Het
Thnsl2 C T 6: 71,139,755 V138I probably benign Het
Tmco3 G A 8: 13,319,605 probably null Het
Tnfrsf1a T C 6: 125,361,596 S235P unknown Het
Tpbg T A 9: 85,844,032 L18* probably null Het
Trabd2b A T 4: 114,610,020 Q482L possibly damaging Het
Trim35 T A 14: 66,297,446 F126Y probably damaging Het
Ttn A T 2: 76,827,944 V12364D unknown Het
Ubac2 A G 14: 121,973,716 Y166C probably damaging Het
Unc13b T A 4: 43,258,519 V1320D probably damaging Het
Usp34 T A 11: 23,460,571 Y2693N Het
Utp20 A T 10: 88,772,459 M1572K probably benign Het
Vmn1r7 C T 6: 57,024,467 M269I probably benign Het
Vmn2r3 C T 3: 64,259,943 G589D probably benign Het
Vrtn A T 12: 84,648,862 M129L probably damaging Het
Zfp273 A T 13: 67,825,064 T104S possibly damaging Het
Zfp384 T A 6: 125,033,312 N390K probably damaging Het
Znfx1 A G 2: 167,042,190 M933T probably benign Het
Other mutations in Malt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Malt1 APN 18 65448963 nonsense probably null
IGL01354:Malt1 APN 18 65475191 missense probably damaging 1.00
IGL01514:Malt1 APN 18 65476400 missense possibly damaging 0.74
IGL01968:Malt1 APN 18 65449016 missense probably benign 0.08
bryce_canyon UTSW 18 65462915 critical splice donor site probably null
mousebird UTSW 18 65475260 critical splice donor site probably null
yellowstone UTSW 18 65458200 missense probably damaging 1.00
H8930:Malt1 UTSW 18 65462815 nonsense probably null
R0319:Malt1 UTSW 18 65462915 critical splice donor site probably null
R0512:Malt1 UTSW 18 65458200 missense probably damaging 1.00
R0748:Malt1 UTSW 18 65475260 critical splice donor site probably null
R2085:Malt1 UTSW 18 65473147 missense probably damaging 1.00
R2962:Malt1 UTSW 18 65448335 missense probably benign 0.01
R4193:Malt1 UTSW 18 65447675 missense probably benign 0.00
R4359:Malt1 UTSW 18 65476229 missense probably benign 0.00
R4913:Malt1 UTSW 18 65476280 missense probably damaging 1.00
R5201:Malt1 UTSW 18 65476055 missense probably benign
R5925:Malt1 UTSW 18 65431368 missense possibly damaging 0.86
R6944:Malt1 UTSW 18 65437920 missense probably benign 0.08
R7108:Malt1 UTSW 18 65464051 missense probably damaging 1.00
R7184:Malt1 UTSW 18 65447693 missense probably benign
R7307:Malt1 UTSW 18 65451569 missense possibly damaging 0.48
R7308:Malt1 UTSW 18 65449609 critical splice donor site probably null
R7490:Malt1 UTSW 18 65448211 missense probably benign 0.04
R7558:Malt1 UTSW 18 65462834 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGTAAAGCAAATTTCTGGCC -3'
(R):5'- TTCTGAAGAAGAGTCCTGAATGGG -3'

Sequencing Primer
(F):5'- AAAGCAAATTTCTGGCCTTTTTCTC -3'
(R):5'- TCGCTCAGTTCTGTGACT -3'
Posted On2019-06-26