Incidental Mutation 'R7193:Rae1'
ID559707
Institutional Source Beutler Lab
Gene Symbol Rae1
Ensembl Gene ENSMUSG00000027509
Gene Nameribonucleic acid export 1
SynonymsD2Ertd342e, MNRP, MNRP41, 41
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7193 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location173000117-173015739 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 173008317 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000029013 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029013] [ENSMUST00000132212]
Predicted Effect probably null
Transcript: ENSMUST00000029013
SMART Domains Protein: ENSMUSP00000029013
Gene: ENSMUSG00000027509

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
WD40 28 70 9.59e-1 SMART
WD40 76 114 9.82e-8 SMART
WD40 117 157 1.12e-2 SMART
Blast:WD40 160 195 2e-9 BLAST
Blast:WD40 202 244 8e-10 BLAST
WD40 250 301 1.14e-3 SMART
Blast:WD40 304 346 7e-22 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000132212
SMART Domains Protein: ENSMUSP00000121815
Gene: ENSMUSG00000027509

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
WD40 28 70 9.59e-1 SMART
WD40 76 114 9.82e-8 SMART
WD40 117 157 1.12e-2 SMART
Blast:WD40 160 195 6e-9 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mutations in the Schizosaccharomyces pombe Rae1 and Saccharomyces cerevisiae Gle2 genes have been shown to result in accumulation of poly(A)-containing mRNA in the nucleus, suggesting that the encoded proteins are involved in RNA export. The protein encoded by this gene is a homolog of yeast Rae1. It contains four WD40 motifs, and has been shown to localize to distinct foci in the nucleoplasm, to the nuclear rim, and to meshwork-like structures throughout the cytoplasm. This gene is thought to be involved in nucleocytoplasmic transport, and in directly or indirectly attaching cytoplasmic mRNPs to the cytoskeleton. Alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are embryonic lethal. Heterozygous mutant mice exhibit a mitotic checkpoint defect and chromosome missegregation as well as an increased incidence of chemically-induced lung tumors; however, no spontaneous tumor formation or signs of early aging are observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A G 12: 71,219,189 probably null Het
4930402H24Rik C A 2: 130,806,788 R258L unknown Het
Abca16 T C 7: 120,427,186 S124P probably damaging Het
Acan A T 7: 79,086,342 S179C probably damaging Het
Atg2b A C 12: 105,664,708 H319Q probably damaging Het
Bptf G A 11: 107,054,809 Q2535* probably null Het
Brpf3 T C 17: 28,836,691 *1205R probably null Het
Cabyr C A 18: 12,751,758 P434Q probably damaging Het
Cacna1g C A 11: 94,409,231 D2268Y possibly damaging Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cct4 A G 11: 22,997,111 T201A probably benign Het
Cdyl2 A C 8: 116,623,994 S133A probably benign Het
Cep76 A G 18: 67,641,134 L14P possibly damaging Het
Col4a3bp T A 13: 96,630,833 probably null Het
Crybg3 A T 16: 59,559,593 S433T possibly damaging Het
Cul9 T C 17: 46,538,497 K574R probably damaging Het
Cyp2u1 T C 3: 131,291,143 I527V probably benign Het
E130309D02Rik A G 5: 143,307,843 V293A probably benign Het
F5 A G 1: 164,219,397 N2142S probably damaging Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Flnc A G 6: 29,450,871 Y1506C probably damaging Het
Foxred2 T A 15: 77,952,030 S376C probably damaging Het
Gbe1 T C 16: 70,495,370 L530P probably damaging Het
Gm8994 A T 6: 136,329,215 I225F probably damaging Het
Hmcn1 T C 1: 150,649,580 R3398G probably null Het
Igf1r T C 7: 68,187,157 L587P probably damaging Het
Kcna3 T C 3: 107,036,537 Y39H probably benign Het
Krtap5-2 GCCACAGCCTCCCTTGCAACCCCCACAGGAGCCACAGCCCCCACAGGAACTACAGCCTCCCTTGCA GCTACAGCCTCCCTTGCA 7: 142,175,243 probably benign Het
Mbl1 T C 14: 41,158,712 F186L probably damaging Het
Ncam2 A T 16: 81,589,795 K687N probably damaging Het
Nedd4l T C 18: 64,997,370 V24A probably damaging Het
Nek1 A G 8: 61,073,578 E661G probably damaging Het
Nudt14 G T 12: 112,939,320 D28E probably benign Het
Olfr1297 A T 2: 111,621,255 V273E probably damaging Het
Olfr134 T A 17: 38,175,096 I4N probably benign Het
Olfr344 T A 2: 36,569,236 C213S probably benign Het
Olfr702 T C 7: 106,824,591 probably benign Het
Pdk4 A T 6: 5,487,089 M319K probably benign Het
Pfkp T C 13: 6,593,216 N522S probably benign Het
Pias2 T C 18: 77,120,121 V234A possibly damaging Het
Pik3c2b C A 1: 133,079,774 H625Q probably benign Het
Pnpla7 T C 2: 25,051,615 S1117P probably damaging Het
Prdm2 A T 4: 143,180,894 V36D probably damaging Het
Prep C T 10: 45,092,699 R98C probably benign Het
Rgs3 T A 4: 62,615,336 V138E probably damaging Het
Rnf185 T C 11: 3,425,329 T142A possibly damaging Het
Rsph6a C A 7: 19,065,647 P401Q probably damaging Het
Runx3 A T 4: 135,121,145 T14S probably benign Het
Scaf11 A G 15: 96,419,161 S841P probably damaging Het
Spta1 T A 1: 174,184,612 L328Q probably damaging Het
Sqor G A 2: 122,804,009 V318M probably damaging Het
Stox2 T C 8: 47,186,454 T902A probably benign Het
Susd3 T C 13: 49,231,203 H248R probably damaging Het
Syne1 T C 10: 5,233,406 Y4133C probably damaging Het
Tbc1d20 C T 2: 152,311,417 T289M probably benign Het
Unc80 T A 1: 66,549,784 F1036Y possibly damaging Het
Zbtb7c T C 18: 76,137,938 C366R probably damaging Het
Zeb1 A T 18: 5,772,756 D1015V probably damaging Het
Zfp606 T G 7: 12,494,039 S696A probably benign Het
Other mutations in Rae1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00813:Rae1 APN 2 173006933 missense probably damaging 0.98
IGL02103:Rae1 APN 2 173003513 missense probably damaging 1.00
R0012:Rae1 UTSW 2 173002673 missense unknown
R0012:Rae1 UTSW 2 173002673 missense unknown
R0684:Rae1 UTSW 2 173005164 missense probably damaging 1.00
R1725:Rae1 UTSW 2 173006961 missense possibly damaging 0.77
R3813:Rae1 UTSW 2 173006873 splice site probably benign
R4537:Rae1 UTSW 2 173015392 utr 3 prime probably benign
R4540:Rae1 UTSW 2 173015392 utr 3 prime probably benign
R4710:Rae1 UTSW 2 173015392 utr 3 prime probably benign
R4731:Rae1 UTSW 2 173015392 utr 3 prime probably benign
R4979:Rae1 UTSW 2 173012608 unclassified probably benign
R6723:Rae1 UTSW 2 173012248 missense probably damaging 1.00
R7329:Rae1 UTSW 2 173009445 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- GAAGGTATGCATGCACTTGAGG -3'
(R):5'- ACAAGTGGCTAGCACACATG -3'

Sequencing Primer
(F):5'- CACTTGAGGGGTTGTGCACTC -3'
(R):5'- ATAGCCCAGCAGTTTCATCTCCAG -3'
Posted On2019-06-26