Incidental Mutation 'R7193:Pdk4'
ID559715
Institutional Source Beutler Lab
Gene Symbol Pdk4
Ensembl Gene ENSMUSG00000019577
Gene Namepyruvate dehydrogenase kinase, isoenzyme 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7193 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location5483351-5496309 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 5487089 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 319 (M319K)
Ref Sequence ENSEMBL: ENSMUSP00000019721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019721] [ENSMUST00000203347]
Predicted Effect probably benign
Transcript: ENSMUST00000019721
AA Change: M319K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000019721
Gene: ENSMUSG00000019577
AA Change: M319K

DomainStartEndE-ValueType
low complexity region 10 19 N/A INTRINSIC
Pfam:BCDHK_Adom3 34 195 1.2e-51 PFAM
HATPase_c 243 368 2.05e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203347
SMART Domains Protein: ENSMUSP00000145377
Gene: ENSMUSG00000019577

DomainStartEndE-ValueType
Pfam:BCDHK_Adom3 1 99 2.3e-25 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the PDK/BCKDK protein kinase family and encodes a mitochondrial protein with a histidine kinase domain. This protein is located in the matrix of the mitrochondria and inhibits the pyruvate dehydrogenase complex by phosphorylating one of its subunits, thereby contributing to the regulation of glucose metabolism. Expression of this gene is regulated by glucocorticoids, retinoic acid and insulin. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered glucose homoeostasis during starvation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A G 12: 71,219,189 probably null Het
4930402H24Rik C A 2: 130,806,788 R258L unknown Het
Abca16 T C 7: 120,427,186 S124P probably damaging Het
Acan A T 7: 79,086,342 S179C probably damaging Het
Atg2b A C 12: 105,664,708 H319Q probably damaging Het
Bptf G A 11: 107,054,809 Q2535* probably null Het
Brpf3 T C 17: 28,836,691 *1205R probably null Het
Cabyr C A 18: 12,751,758 P434Q probably damaging Het
Cacna1g C A 11: 94,409,231 D2268Y possibly damaging Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cct4 A G 11: 22,997,111 T201A probably benign Het
Cdyl2 A C 8: 116,623,994 S133A probably benign Het
Cep76 A G 18: 67,641,134 L14P possibly damaging Het
Col4a3bp T A 13: 96,630,833 probably null Het
Crybg3 A T 16: 59,559,593 S433T possibly damaging Het
Cul9 T C 17: 46,538,497 K574R probably damaging Het
Cyp2u1 T C 3: 131,291,143 I527V probably benign Het
E130309D02Rik A G 5: 143,307,843 V293A probably benign Het
F5 A G 1: 164,219,397 N2142S probably damaging Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Flnc A G 6: 29,450,871 Y1506C probably damaging Het
Foxred2 T A 15: 77,952,030 S376C probably damaging Het
Gbe1 T C 16: 70,495,370 L530P probably damaging Het
Gm8994 A T 6: 136,329,215 I225F probably damaging Het
Hmcn1 T C 1: 150,649,580 R3398G probably null Het
Igf1r T C 7: 68,187,157 L587P probably damaging Het
Kcna3 T C 3: 107,036,537 Y39H probably benign Het
Krtap5-2 GCCACAGCCTCCCTTGCAACCCCCACAGGAGCCACAGCCCCCACAGGAACTACAGCCTCCCTTGCA GCTACAGCCTCCCTTGCA 7: 142,175,243 probably benign Het
Mbl1 T C 14: 41,158,712 F186L probably damaging Het
Ncam2 A T 16: 81,589,795 K687N probably damaging Het
Nedd4l T C 18: 64,997,370 V24A probably damaging Het
Nek1 A G 8: 61,073,578 E661G probably damaging Het
Nudt14 G T 12: 112,939,320 D28E probably benign Het
Olfr1297 A T 2: 111,621,255 V273E probably damaging Het
Olfr134 T A 17: 38,175,096 I4N probably benign Het
Olfr344 T A 2: 36,569,236 C213S probably benign Het
Olfr702 T C 7: 106,824,591 probably benign Het
Pfkp T C 13: 6,593,216 N522S probably benign Het
Pias2 T C 18: 77,120,121 V234A possibly damaging Het
Pik3c2b C A 1: 133,079,774 H625Q probably benign Het
Pnpla7 T C 2: 25,051,615 S1117P probably damaging Het
Prdm2 A T 4: 143,180,894 V36D probably damaging Het
Prep C T 10: 45,092,699 R98C probably benign Het
Rae1 T C 2: 173,008,317 probably null Het
Rgs3 T A 4: 62,615,336 V138E probably damaging Het
Rnf185 T C 11: 3,425,329 T142A possibly damaging Het
Rsph6a C A 7: 19,065,647 P401Q probably damaging Het
Runx3 A T 4: 135,121,145 T14S probably benign Het
Scaf11 A G 15: 96,419,161 S841P probably damaging Het
Spta1 T A 1: 174,184,612 L328Q probably damaging Het
Sqor G A 2: 122,804,009 V318M probably damaging Het
Stox2 T C 8: 47,186,454 T902A probably benign Het
Susd3 T C 13: 49,231,203 H248R probably damaging Het
Syne1 T C 10: 5,233,406 Y4133C probably damaging Het
Tbc1d20 C T 2: 152,311,417 T289M probably benign Het
Unc80 T A 1: 66,549,784 F1036Y possibly damaging Het
Zbtb7c T C 18: 76,137,938 C366R probably damaging Het
Zeb1 A T 18: 5,772,756 D1015V probably damaging Het
Zfp606 T G 7: 12,494,039 S696A probably benign Het
Other mutations in Pdk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01337:Pdk4 APN 6 5491869 missense probably benign 0.16
IGL01524:Pdk4 APN 6 5491979 missense probably damaging 1.00
IGL01814:Pdk4 APN 6 5491828 critical splice donor site probably null
IGL02136:Pdk4 APN 6 5486715 missense probably damaging 1.00
IGL02630:Pdk4 APN 6 5491671 missense possibly damaging 0.63
IGL02689:Pdk4 APN 6 5487408 missense probably benign 0.44
R0277:Pdk4 UTSW 6 5491620 missense probably damaging 1.00
R0335:Pdk4 UTSW 6 5491138 missense probably benign 0.00
R0990:Pdk4 UTSW 6 5485577 missense probably benign 0.39
R1792:Pdk4 UTSW 6 5489166 missense probably damaging 1.00
R2043:Pdk4 UTSW 6 5485502 missense probably benign 0.05
R2091:Pdk4 UTSW 6 5494857 intron probably benign
R4074:Pdk4 UTSW 6 5491865 missense probably benign 0.13
R4916:Pdk4 UTSW 6 5489157 missense possibly damaging 0.79
R5414:Pdk4 UTSW 6 5485499 missense probably benign
R5867:Pdk4 UTSW 6 5487452 missense probably benign
R6772:Pdk4 UTSW 6 5487141 missense probably benign
R7146:Pdk4 UTSW 6 5491068 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACTGATACCTCCTCCTAGTCAG -3'
(R):5'- ACATGTGCCCTGTGACTTTG -3'

Sequencing Primer
(F):5'- CTCCTAGTCAGAGTTCTTAGGATC -3'
(R):5'- GCCCTGTGACTTTGAAGAGAG -3'
Posted On2019-06-26