Incidental Mutation 'R7193:Rsph6a'
ID559719
Institutional Source Beutler Lab
Gene Symbol Rsph6a
Ensembl Gene ENSMUSG00000040866
Gene Nameradial spoke head 6 homolog A (Chlamydomonas)
SynonymsRSP4, Rshl1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R7193 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location19054690-19074447 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 19065647 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 401 (P401Q)
Ref Sequence ENSEMBL: ENSMUSP00000046526 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035521] [ENSMUST00000076887]
Predicted Effect probably damaging
Transcript: ENSMUST00000035521
AA Change: P401Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046526
Gene: ENSMUSG00000040866
AA Change: P401Q

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Pfam:Radial_spoke 191 685 2.3e-200 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000076887
SMART Domains Protein: ENSMUSP00000076153
Gene: ENSMUSG00000040866

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Pfam:Radial_spoke 188 287 3e-18 PFAM
Pfam:Radial_spoke 285 433 4.6e-53 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar to a sea urchin radial spoke head protein. Radial spoke protein complexes form part of the axoneme of eukaryotic flagella and are located between the axoneme's outer ring of doublet microtubules and central pair of microtubules. In Chlamydomonas, radial spoke proteins are thought to regulate the activity of dynein and the symmetry of flagellar bending patterns. This gene maps to a region of chromosome 19 that is linked to primary ciliary dyskinesia-2 (CILD2). [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A G 12: 71,219,189 probably null Het
4930402H24Rik C A 2: 130,806,788 R258L unknown Het
Abca16 T C 7: 120,427,186 S124P probably damaging Het
Acan A T 7: 79,086,342 S179C probably damaging Het
Atg2b A C 12: 105,664,708 H319Q probably damaging Het
Bptf G A 11: 107,054,809 Q2535* probably null Het
Brpf3 T C 17: 28,836,691 *1205R probably null Het
Cabyr C A 18: 12,751,758 P434Q probably damaging Het
Cacna1g C A 11: 94,409,231 D2268Y possibly damaging Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cct4 A G 11: 22,997,111 T201A probably benign Het
Cdyl2 A C 8: 116,623,994 S133A probably benign Het
Cep76 A G 18: 67,641,134 L14P possibly damaging Het
Col4a3bp T A 13: 96,630,833 probably null Het
Crybg3 A T 16: 59,559,593 S433T possibly damaging Het
Cul9 T C 17: 46,538,497 K574R probably damaging Het
Cyp2u1 T C 3: 131,291,143 I527V probably benign Het
E130309D02Rik A G 5: 143,307,843 V293A probably benign Het
F5 A G 1: 164,219,397 N2142S probably damaging Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Flnc A G 6: 29,450,871 Y1506C probably damaging Het
Foxred2 T A 15: 77,952,030 S376C probably damaging Het
Gbe1 T C 16: 70,495,370 L530P probably damaging Het
Gm8994 A T 6: 136,329,215 I225F probably damaging Het
Hmcn1 T C 1: 150,649,580 R3398G probably null Het
Igf1r T C 7: 68,187,157 L587P probably damaging Het
Kcna3 T C 3: 107,036,537 Y39H probably benign Het
Krtap5-2 GCCACAGCCTCCCTTGCAACCCCCACAGGAGCCACAGCCCCCACAGGAACTACAGCCTCCCTTGCA GCTACAGCCTCCCTTGCA 7: 142,175,243 probably benign Het
Mbl1 T C 14: 41,158,712 F186L probably damaging Het
Ncam2 A T 16: 81,589,795 K687N probably damaging Het
Nedd4l T C 18: 64,997,370 V24A probably damaging Het
Nek1 A G 8: 61,073,578 E661G probably damaging Het
Nudt14 G T 12: 112,939,320 D28E probably benign Het
Olfr1297 A T 2: 111,621,255 V273E probably damaging Het
Olfr134 T A 17: 38,175,096 I4N probably benign Het
Olfr344 T A 2: 36,569,236 C213S probably benign Het
Olfr702 T C 7: 106,824,591 probably benign Het
Pdk4 A T 6: 5,487,089 M319K probably benign Het
Pfkp T C 13: 6,593,216 N522S probably benign Het
Pias2 T C 18: 77,120,121 V234A possibly damaging Het
Pik3c2b C A 1: 133,079,774 H625Q probably benign Het
Pnpla7 T C 2: 25,051,615 S1117P probably damaging Het
Prdm2 A T 4: 143,180,894 V36D probably damaging Het
Prep C T 10: 45,092,699 R98C probably benign Het
Rae1 T C 2: 173,008,317 probably null Het
Rgs3 T A 4: 62,615,336 V138E probably damaging Het
Rnf185 T C 11: 3,425,329 T142A possibly damaging Het
Runx3 A T 4: 135,121,145 T14S probably benign Het
Scaf11 A G 15: 96,419,161 S841P probably damaging Het
Spta1 T A 1: 174,184,612 L328Q probably damaging Het
Sqor G A 2: 122,804,009 V318M probably damaging Het
Stox2 T C 8: 47,186,454 T902A probably benign Het
Susd3 T C 13: 49,231,203 H248R probably damaging Het
Syne1 T C 10: 5,233,406 Y4133C probably damaging Het
Tbc1d20 C T 2: 152,311,417 T289M probably benign Het
Unc80 T A 1: 66,549,784 F1036Y possibly damaging Het
Zbtb7c T C 18: 76,137,938 C366R probably damaging Het
Zeb1 A T 18: 5,772,756 D1015V probably damaging Het
Zfp606 T G 7: 12,494,039 S696A probably benign Het
Other mutations in Rsph6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01060:Rsph6a APN 7 19054868 nonsense probably null
IGL01656:Rsph6a APN 7 19054845 missense probably benign 0.00
IGL02997:Rsph6a APN 7 19054839 missense probably benign 0.32
R0396:Rsph6a UTSW 7 19074106 missense probably damaging 1.00
R0467:Rsph6a UTSW 7 19057669 missense possibly damaging 0.95
R0545:Rsph6a UTSW 7 19054946 nonsense probably null
R0603:Rsph6a UTSW 7 19065961 missense possibly damaging 0.66
R0848:Rsph6a UTSW 7 19057670 missense probably benign 0.07
R1943:Rsph6a UTSW 7 19074076 missense probably damaging 1.00
R2133:Rsph6a UTSW 7 19068106 missense probably damaging 1.00
R3713:Rsph6a UTSW 7 19057550 missense probably damaging 0.98
R3762:Rsph6a UTSW 7 19055331 missense probably damaging 1.00
R3826:Rsph6a UTSW 7 19057614 missense probably damaging 1.00
R3827:Rsph6a UTSW 7 19057614 missense probably damaging 1.00
R3828:Rsph6a UTSW 7 19057614 missense probably damaging 1.00
R4355:Rsph6a UTSW 7 19067078 splice site probably null
R4429:Rsph6a UTSW 7 19074063 missense probably damaging 1.00
R4524:Rsph6a UTSW 7 19066045 missense probably damaging 1.00
R4799:Rsph6a UTSW 7 19065858 nonsense probably null
R4896:Rsph6a UTSW 7 19057740 missense possibly damaging 0.67
R4906:Rsph6a UTSW 7 19068072 missense possibly damaging 0.92
R5004:Rsph6a UTSW 7 19057740 missense possibly damaging 0.67
R5637:Rsph6a UTSW 7 19054895 missense probably benign
R6066:Rsph6a UTSW 7 19065815 missense probably damaging 1.00
R7013:Rsph6a UTSW 7 19054895 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAAGCTTCCGAATCTTCCTGGC -3'
(R):5'- AGATAGTTGGCCTCGTTGC -3'

Sequencing Primer
(F):5'- AATCTTCCTGGCCCTGAAGCAG -3'
(R):5'- GCGGATAGCTGATGACCG -3'
Posted On2019-06-26