Incidental Mutation 'R0591:Gpr12'
ID55972
Institutional Source Beutler Lab
Gene Symbol Gpr12
Ensembl Gene ENSMUSG00000041468
Gene NameG-protein coupled receptor 12
SynonymsGpcr12, Gpcr01, Gpcr20
MMRRC Submission 038781-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.370) question?
Stock #R0591 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location146582398-146585239 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 146583635 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 159 (V159A)
Ref Sequence ENSEMBL: ENSMUSP00000142889 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036211] [ENSMUST00000197431] [ENSMUST00000197825] [ENSMUST00000200112]
Predicted Effect probably benign
Transcript: ENSMUST00000036211
AA Change: V159A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000038245
Gene: ENSMUSG00000041468
AA Change: V159A

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 56 236 2.9e-7 PFAM
Pfam:7tm_1 61 301 5.3e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196096
Predicted Effect probably benign
Transcript: ENSMUST00000197431
AA Change: V159A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000142889
Gene: ENSMUSG00000041468
AA Change: V159A

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 56 236 2.9e-7 PFAM
Pfam:7tm_1 61 301 2.1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197825
SMART Domains Protein: ENSMUSP00000143415
Gene: ENSMUSG00000041468

DomainStartEndE-ValueType
Pfam:7tm_1 61 152 5.3e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200112
SMART Domains Protein: ENSMUSP00000143653
Gene: ENSMUSG00000041468

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
transmembrane domain 35 53 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200363
Meta Mutation Damage Score 0.124 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.2%
  • 10x: 97.7%
  • 20x: 95.3%
Validation Efficiency 100% (62/62)
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in obesity, increased cholesterol, glucose and triglyceride levels and decreased energy expenditure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G T 3: 138,068,943 E1298* probably null Het
Adam19 T C 11: 46,121,411 probably benign Het
Agt A T 8: 124,556,939 S480R possibly damaging Het
Anapc1 G T 2: 128,619,332 D1769E probably benign Het
Aox4 T C 1: 58,239,102 probably benign Het
Apol9b G A 15: 77,735,630 V209I possibly damaging Het
Appl2 A T 10: 83,624,645 I116K possibly damaging Het
B230118H07Rik A T 2: 101,576,117 D155E probably benign Het
BC051665 A G 13: 60,784,608 probably benign Het
Cactin G T 10: 81,324,003 E89* probably null Het
Carf G T 1: 60,125,914 probably benign Het
Ccdc167 A G 17: 29,705,261 probably benign Het
Ceacam3 G A 7: 17,151,883 probably null Het
Clca4b T A 3: 144,915,592 K574* probably null Het
Crabp1 T A 9: 54,765,603 I64N probably damaging Het
Dgkd T A 1: 87,915,104 I118N probably damaging Het
Dglucy T C 12: 100,859,518 probably benign Het
Dock10 C T 1: 80,541,219 probably benign Het
Ednrb A T 14: 103,823,274 probably null Het
Ercc6 T C 14: 32,558,016 probably benign Het
Gm5538 C A 3: 59,752,129 Y334* probably null Het
Golga3 A C 5: 110,188,743 Q416P probably damaging Het
Heatr5a A T 12: 51,910,101 probably benign Het
Helz2 A G 2: 181,232,116 I2195T probably damaging Het
Hikeshi A T 7: 89,920,087 N76K possibly damaging Het
Hsd11b1 T C 1: 193,229,676 probably benign Het
Inhba A T 13: 16,026,820 K322N probably damaging Het
Katnal1 A T 5: 148,892,516 F291L probably damaging Het
Kcnj9 T C 1: 172,323,098 E316G probably damaging Het
Lrsam1 A G 2: 32,933,923 probably benign Het
Mcf2l T G 8: 13,018,751 S1075A probably benign Het
Mios T C 6: 8,215,470 V222A possibly damaging Het
Mycbp2 A T 14: 103,196,391 probably benign Het
Nars A T 18: 64,500,567 I544N probably damaging Het
Olfr993 A G 2: 85,414,690 L63P possibly damaging Het
Pbrm1 A G 14: 31,046,430 probably benign Het
Plcb4 A G 2: 135,955,012 probably benign Het
Pnliprp1 A G 19: 58,734,706 D213G probably damaging Het
Psap A G 10: 60,300,855 N538D possibly damaging Het
Ptdss1 A G 13: 66,972,650 probably benign Het
Rap1b G A 10: 117,818,617 probably benign Het
Rhcg T A 7: 79,594,772 probably benign Het
Ryr1 G A 7: 29,104,795 T550I possibly damaging Het
Samm50 G A 15: 84,211,168 G452R probably benign Het
Scin A G 12: 40,080,930 probably null Het
Sesn3 T C 9: 14,308,558 L81S probably damaging Het
Skint6 A C 4: 112,858,169 probably benign Het
Slc30a4 A T 2: 122,685,240 L411H probably damaging Het
Slc44a5 C T 3: 154,234,145 probably benign Het
Slc4a3 C T 1: 75,549,021 A255V probably damaging Het
Slc9b1 A G 3: 135,382,832 N318S possibly damaging Het
Tcp11l2 A T 10: 84,604,594 H287L probably benign Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tnks2 T A 19: 36,872,562 Y605N probably damaging Het
Topbp1 T A 9: 103,349,838 N1490K probably benign Het
Ube4b T G 4: 149,357,577 probably benign Het
Usp4 G A 9: 108,348,029 probably benign Het
Vezf1 A T 11: 88,068,435 probably benign Het
Vmn1r184 A T 7: 26,267,075 D82V probably damaging Het
Other mutations in Gpr12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02404:Gpr12 APN 5 146583923 missense probably damaging 1.00
IGL03225:Gpr12 APN 5 146583951 missense probably damaging 1.00
IGL02799:Gpr12 UTSW 5 146583819 missense possibly damaging 0.92
R0380:Gpr12 UTSW 5 146583336 missense probably damaging 1.00
R0786:Gpr12 UTSW 5 146583504 missense probably damaging 0.96
R1432:Gpr12 UTSW 5 146583425 missense probably damaging 1.00
R5994:Gpr12 UTSW 5 146583431 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTAGTCACATAGTGCGATGTAGCC -3'
(R):5'- TGCTTCAGTCAGAAGCCACCAAG -3'

Sequencing Primer
(F):5'- GCGTGCCTCATCACAATC -3'
(R):5'- AAGCTGGTCACCATCGGAC -3'
Posted On2013-07-11