Incidental Mutation 'R7193:Pfkp'
ID559737
Institutional Source Beutler Lab
Gene Symbol Pfkp
Ensembl Gene ENSMUSG00000021196
Gene Namephosphofructokinase, platelet
Synonyms9330125N24Rik, 1200015H23Rik, PFK-C
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.312) question?
Stock #R7193 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location6579768-6648777 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 6593216 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 522 (N522S)
Ref Sequence ENSEMBL: ENSMUSP00000021614 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021614] [ENSMUST00000138703] [ENSMUST00000154100]
Predicted Effect probably benign
Transcript: ENSMUST00000021614
AA Change: N522S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000021614
Gene: ENSMUSG00000021196
AA Change: N522S

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
Pfam:PFK 25 332 4.7e-114 PFAM
Pfam:PFK 411 696 1.2e-96 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133041
SMART Domains Protein: ENSMUSP00000123662
Gene: ENSMUSG00000021196

DomainStartEndE-ValueType
Pfam:PFK 1 66 4.4e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138703
SMART Domains Protein: ENSMUSP00000117030
Gene: ENSMUSG00000021196

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
Pfam:PFK 24 334 6.7e-136 PFAM
Pfam:PFK 410 698 1.1e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154100
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the phosphofructokinase A protein family. The encoded enzyme is the platelet-specific isoform of phosphofructokinase and plays a key role in glycolysis regulation. This gene may play a role in metabolic reprogramming in some cancers, including clear cell renal cell carcinomas, and cancer of the bladder, breast, and lung. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A G 12: 71,219,189 probably null Het
4930402H24Rik C A 2: 130,806,788 R258L unknown Het
Abca16 T C 7: 120,427,186 S124P probably damaging Het
Acan A T 7: 79,086,342 S179C probably damaging Het
Atg2b A C 12: 105,664,708 H319Q probably damaging Het
Bptf G A 11: 107,054,809 Q2535* probably null Het
Brpf3 T C 17: 28,836,691 *1205R probably null Het
Cabyr C A 18: 12,751,758 P434Q probably damaging Het
Cacna1g C A 11: 94,409,231 D2268Y possibly damaging Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cct4 A G 11: 22,997,111 T201A probably benign Het
Cdyl2 A C 8: 116,623,994 S133A probably benign Het
Cep76 A G 18: 67,641,134 L14P possibly damaging Het
Col4a3bp T A 13: 96,630,833 probably null Het
Crybg3 A T 16: 59,559,593 S433T possibly damaging Het
Cul9 T C 17: 46,538,497 K574R probably damaging Het
Cyp2u1 T C 3: 131,291,143 I527V probably benign Het
E130309D02Rik A G 5: 143,307,843 V293A probably benign Het
F5 A G 1: 164,219,397 N2142S probably damaging Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Flnc A G 6: 29,450,871 Y1506C probably damaging Het
Foxred2 T A 15: 77,952,030 S376C probably damaging Het
Gbe1 T C 16: 70,495,370 L530P probably damaging Het
Gm8994 A T 6: 136,329,215 I225F probably damaging Het
Hmcn1 T C 1: 150,649,580 R3398G probably null Het
Igf1r T C 7: 68,187,157 L587P probably damaging Het
Kcna3 T C 3: 107,036,537 Y39H probably benign Het
Krtap5-2 GCCACAGCCTCCCTTGCAACCCCCACAGGAGCCACAGCCCCCACAGGAACTACAGCCTCCCTTGCA GCTACAGCCTCCCTTGCA 7: 142,175,243 probably benign Het
Mbl1 T C 14: 41,158,712 F186L probably damaging Het
Ncam2 A T 16: 81,589,795 K687N probably damaging Het
Nedd4l T C 18: 64,997,370 V24A probably damaging Het
Nek1 A G 8: 61,073,578 E661G probably damaging Het
Nudt14 G T 12: 112,939,320 D28E probably benign Het
Olfr1297 A T 2: 111,621,255 V273E probably damaging Het
Olfr134 T A 17: 38,175,096 I4N probably benign Het
Olfr344 T A 2: 36,569,236 C213S probably benign Het
Olfr702 T C 7: 106,824,591 probably benign Het
Pdk4 A T 6: 5,487,089 M319K probably benign Het
Pias2 T C 18: 77,120,121 V234A possibly damaging Het
Pik3c2b C A 1: 133,079,774 H625Q probably benign Het
Pnpla7 T C 2: 25,051,615 S1117P probably damaging Het
Prdm2 A T 4: 143,180,894 V36D probably damaging Het
Prep C T 10: 45,092,699 R98C probably benign Het
Rae1 T C 2: 173,008,317 probably null Het
Rgs3 T A 4: 62,615,336 V138E probably damaging Het
Rnf185 T C 11: 3,425,329 T142A possibly damaging Het
Rsph6a C A 7: 19,065,647 P401Q probably damaging Het
Runx3 A T 4: 135,121,145 T14S probably benign Het
Scaf11 A G 15: 96,419,161 S841P probably damaging Het
Spta1 T A 1: 174,184,612 L328Q probably damaging Het
Sqor G A 2: 122,804,009 V318M probably damaging Het
Stox2 T C 8: 47,186,454 T902A probably benign Het
Susd3 T C 13: 49,231,203 H248R probably damaging Het
Syne1 T C 10: 5,233,406 Y4133C probably damaging Het
Tbc1d20 C T 2: 152,311,417 T289M probably benign Het
Unc80 T A 1: 66,549,784 F1036Y possibly damaging Het
Zbtb7c T C 18: 76,137,938 C366R probably damaging Het
Zeb1 A T 18: 5,772,756 D1015V probably damaging Het
Zfp606 T G 7: 12,494,039 S696A probably benign Het
Other mutations in Pfkp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Pfkp APN 13 6619550 missense probably damaging 1.00
IGL00983:Pfkp APN 13 6581567 missense probably damaging 1.00
IGL01099:Pfkp APN 13 6603390 splice site probably benign
IGL01825:Pfkp APN 13 6620978 missense probably damaging 1.00
IGL02164:Pfkp APN 13 6597915 missense probably damaging 1.00
IGL02331:Pfkp APN 13 6597960 missense probably benign 0.33
IGL02680:Pfkp APN 13 6600672 unclassified probably benign
IGL02852:Pfkp APN 13 6605023 missense possibly damaging 0.57
R0414:Pfkp UTSW 13 6593210 missense probably benign 0.03
R0542:Pfkp UTSW 13 6621992 nonsense probably null
R0612:Pfkp UTSW 13 6605634 critical splice donor site probably null
R0767:Pfkp UTSW 13 6605012 missense probably damaging 0.98
R1417:Pfkp UTSW 13 6605719 missense probably benign 0.00
R1534:Pfkp UTSW 13 6619538 missense probably damaging 1.00
R1612:Pfkp UTSW 13 6588589 missense probably damaging 1.00
R2278:Pfkp UTSW 13 6619209 unclassified probably null
R2919:Pfkp UTSW 13 6593243 missense probably damaging 0.98
R2996:Pfkp UTSW 13 6635930 missense probably benign 0.01
R4214:Pfkp UTSW 13 6619225 missense probably damaging 0.99
R4374:Pfkp UTSW 13 6620989 missense probably damaging 1.00
R4693:Pfkp UTSW 13 6600635 missense possibly damaging 0.91
R5534:Pfkp UTSW 13 6648583 missense probably damaging 1.00
R5537:Pfkp UTSW 13 6619242 missense probably damaging 1.00
R5619:Pfkp UTSW 13 6598729 unclassified probably benign
R5677:Pfkp UTSW 13 6588595 missense probably damaging 1.00
R6038:Pfkp UTSW 13 6597969 missense probably benign 0.14
R6038:Pfkp UTSW 13 6597969 missense probably benign 0.14
R6216:Pfkp UTSW 13 6619188 missense probably benign 0.00
R6330:Pfkp UTSW 13 6585250 unclassified probably benign
R6676:Pfkp UTSW 13 6586539 missense possibly damaging 0.74
R7044:Pfkp UTSW 13 6581567 missense probably damaging 1.00
R7146:Pfkp UTSW 13 6602781 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGAGAACAACCCCGTTCAG -3'
(R):5'- AGTTGAAGCATGCCCTTCGC -3'

Sequencing Primer
(F):5'- CCGTTCAGGCAAAGCAAAG -3'
(R):5'- TGCCCAGATGCCAATTCTGG -3'
Posted On2019-06-26