Incidental Mutation 'R7193:Col4a3bp'
ID559740
Institutional Source Beutler Lab
Gene Symbol Col4a3bp
Ensembl Gene ENSMUSG00000021669
Gene Namecollagen, type IV, alpha 3 (Goodpasture antigen) binding protein
SynonymsGPBP, 2810404O15Rik, Cert, ceramide transport protein, 9230101K08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7193 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location96542618-96640167 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 96630833 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000076856 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077672] [ENSMUST00000109444] [ENSMUST00000179226]
Predicted Effect probably null
Transcript: ENSMUST00000077672
SMART Domains Protein: ENSMUSP00000076856
Gene: ENSMUSG00000021669

DomainStartEndE-ValueType
PH 24 119 4.52e-21 SMART
low complexity region 138 150 N/A INTRINSIC
coiled coil region 273 301 N/A INTRINSIC
START 398 619 1.15e-19 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109444
SMART Domains Protein: ENSMUSP00000105070
Gene: ENSMUSG00000021669

DomainStartEndE-ValueType
PH 24 119 4.52e-21 SMART
low complexity region 138 150 N/A INTRINSIC
coiled coil region 273 301 N/A INTRINSIC
START 372 593 1.15e-19 SMART
Predicted Effect probably null
Transcript: ENSMUST00000179226
SMART Domains Protein: ENSMUSP00000136766
Gene: ENSMUSG00000021669

DomainStartEndE-ValueType
PH 24 119 4.52e-21 SMART
low complexity region 138 150 N/A INTRINSIC
coiled coil region 273 301 N/A INTRINSIC
START 372 593 1.15e-19 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a kinase that specifically phosphorylates the N-terminal region of the non-collagenous domain of the alpha 3 chain of type IV collagen, known as the Goodpasture antigen. Goodpasture disease is the result of an autoimmune response directed at this antigen. One isoform of this protein is also involved in ceramide intracellular transport. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mice display embryonic lethality during organogenesis with reduced embryo size, impaired heart function, abnormal heart morphology, abnormal mitochondrial morphology and physiology, abnormal endoplasmic reticulum morphology, and decreased cell proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A G 12: 71,219,189 probably null Het
4930402H24Rik C A 2: 130,806,788 R258L unknown Het
Abca16 T C 7: 120,427,186 S124P probably damaging Het
Acan A T 7: 79,086,342 S179C probably damaging Het
Atg2b A C 12: 105,664,708 H319Q probably damaging Het
Bptf G A 11: 107,054,809 Q2535* probably null Het
Brpf3 T C 17: 28,836,691 *1205R probably null Het
Cabyr C A 18: 12,751,758 P434Q probably damaging Het
Cacna1g C A 11: 94,409,231 D2268Y possibly damaging Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cct4 A G 11: 22,997,111 T201A probably benign Het
Cdyl2 A C 8: 116,623,994 S133A probably benign Het
Cep76 A G 18: 67,641,134 L14P possibly damaging Het
Crybg3 A T 16: 59,559,593 S433T possibly damaging Het
Cul9 T C 17: 46,538,497 K574R probably damaging Het
Cyp2u1 T C 3: 131,291,143 I527V probably benign Het
E130309D02Rik A G 5: 143,307,843 V293A probably benign Het
F5 A G 1: 164,219,397 N2142S probably damaging Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Flnc A G 6: 29,450,871 Y1506C probably damaging Het
Foxred2 T A 15: 77,952,030 S376C probably damaging Het
Gbe1 T C 16: 70,495,370 L530P probably damaging Het
Gm8994 A T 6: 136,329,215 I225F probably damaging Het
Hmcn1 T C 1: 150,649,580 R3398G probably null Het
Igf1r T C 7: 68,187,157 L587P probably damaging Het
Kcna3 T C 3: 107,036,537 Y39H probably benign Het
Krtap5-2 GCCACAGCCTCCCTTGCAACCCCCACAGGAGCCACAGCCCCCACAGGAACTACAGCCTCCCTTGCA GCTACAGCCTCCCTTGCA 7: 142,175,243 probably benign Het
Mbl1 T C 14: 41,158,712 F186L probably damaging Het
Ncam2 A T 16: 81,589,795 K687N probably damaging Het
Nedd4l T C 18: 64,997,370 V24A probably damaging Het
Nek1 A G 8: 61,073,578 E661G probably damaging Het
Nudt14 G T 12: 112,939,320 D28E probably benign Het
Olfr1297 A T 2: 111,621,255 V273E probably damaging Het
Olfr134 T A 17: 38,175,096 I4N probably benign Het
Olfr344 T A 2: 36,569,236 C213S probably benign Het
Olfr702 T C 7: 106,824,591 probably benign Het
Pdk4 A T 6: 5,487,089 M319K probably benign Het
Pfkp T C 13: 6,593,216 N522S probably benign Het
Pias2 T C 18: 77,120,121 V234A possibly damaging Het
Pik3c2b C A 1: 133,079,774 H625Q probably benign Het
Pnpla7 T C 2: 25,051,615 S1117P probably damaging Het
Prdm2 A T 4: 143,180,894 V36D probably damaging Het
Prep C T 10: 45,092,699 R98C probably benign Het
Rae1 T C 2: 173,008,317 probably null Het
Rgs3 T A 4: 62,615,336 V138E probably damaging Het
Rnf185 T C 11: 3,425,329 T142A possibly damaging Het
Rsph6a C A 7: 19,065,647 P401Q probably damaging Het
Runx3 A T 4: 135,121,145 T14S probably benign Het
Scaf11 A G 15: 96,419,161 S841P probably damaging Het
Spta1 T A 1: 174,184,612 L328Q probably damaging Het
Sqor G A 2: 122,804,009 V318M probably damaging Het
Stox2 T C 8: 47,186,454 T902A probably benign Het
Susd3 T C 13: 49,231,203 H248R probably damaging Het
Syne1 T C 10: 5,233,406 Y4133C probably damaging Het
Tbc1d20 C T 2: 152,311,417 T289M probably benign Het
Unc80 T A 1: 66,549,784 F1036Y possibly damaging Het
Zbtb7c T C 18: 76,137,938 C366R probably damaging Het
Zeb1 A T 18: 5,772,756 D1015V probably damaging Het
Zfp606 T G 7: 12,494,039 S696A probably benign Het
Other mutations in Col4a3bp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:Col4a3bp APN 13 96614802 missense probably damaging 0.99
IGL02121:Col4a3bp APN 13 96599474 missense probably benign 0.45
IGL02207:Col4a3bp APN 13 96624792 critical splice donor site probably null
IGL02285:Col4a3bp APN 13 96616482 missense probably benign 0.10
IGL02425:Col4a3bp APN 13 96609882 missense probably damaging 1.00
IGL02749:Col4a3bp APN 13 96629135 missense possibly damaging 0.60
IGL03288:Col4a3bp APN 13 96634192 missense probably benign 0.00
PIT4508001:Col4a3bp UTSW 13 96630776 missense probably damaging 1.00
R0197:Col4a3bp UTSW 13 96549287 missense probably benign 0.05
R0317:Col4a3bp UTSW 13 96634121 nonsense probably null
R2103:Col4a3bp UTSW 13 96634886 missense probably damaging 1.00
R2104:Col4a3bp UTSW 13 96634886 missense probably damaging 1.00
R4664:Col4a3bp UTSW 13 96599457 missense probably benign 0.01
R4782:Col4a3bp UTSW 13 96612265 missense probably benign
R4824:Col4a3bp UTSW 13 96616487 missense probably benign
R5060:Col4a3bp UTSW 13 96603155 missense probably benign 0.37
R5131:Col4a3bp UTSW 13 96614835 missense probably damaging 1.00
R5385:Col4a3bp UTSW 13 96629067 missense possibly damaging 0.94
R5503:Col4a3bp UTSW 13 96543239 missense possibly damaging 0.61
R6034:Col4a3bp UTSW 13 96609800 missense probably benign 0.06
R6034:Col4a3bp UTSW 13 96609800 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CACTGGCCGTCTTCCATTTAGATA -3'
(R):5'- TCAGGTTGTAATCATCTTCTTTCTCA -3'

Sequencing Primer
(F):5'- GATATAGCATAGGCATTCTACTTGC -3'
(R):5'- ACATCTGCTACACATATGCTGGGG -3'
Posted On2019-06-26