Incidental Mutation 'R7193:Foxred2'
ID559742
Institutional Source Beutler Lab
Gene Symbol Foxred2
Ensembl Gene ENSMUSG00000016552
Gene NameFAD-dependent oxidoreductase domain containing 2
SynonymsD15Bwg0759e, A430097D04Rik, LOC239554
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7193 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location77940522-77956722 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 77952030 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 376 (S376C)
Ref Sequence ENSEMBL: ENSMUSP00000016696 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016696] [ENSMUST00000117725]
Predicted Effect probably damaging
Transcript: ENSMUST00000016696
AA Change: S376C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000016696
Gene: ENSMUSG00000016552
AA Change: S376C

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Pyr_redox_2 22 243 2.9e-11 PFAM
Pfam:Pyr_redox_3 25 240 9.3e-35 PFAM
Pfam:NAD_binding_8 26 84 3.3e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000117725
AA Change: S376C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113403
Gene: ENSMUSG00000016552
AA Change: S376C

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Pyr_redox_2 23 478 3.4e-9 PFAM
Pfam:Pyr_redox_3 25 240 6.2e-37 PFAM
Pfam:NAD_binding_8 26 90 4.8e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A G 12: 71,219,189 probably null Het
4930402H24Rik C A 2: 130,806,788 R258L unknown Het
Abca16 T C 7: 120,427,186 S124P probably damaging Het
Acan A T 7: 79,086,342 S179C probably damaging Het
Atg2b A C 12: 105,664,708 H319Q probably damaging Het
Bptf G A 11: 107,054,809 Q2535* probably null Het
Brpf3 T C 17: 28,836,691 *1205R probably null Het
Cabyr C A 18: 12,751,758 P434Q probably damaging Het
Cacna1g C A 11: 94,409,231 D2268Y possibly damaging Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cct4 A G 11: 22,997,111 T201A probably benign Het
Cdyl2 A C 8: 116,623,994 S133A probably benign Het
Cep76 A G 18: 67,641,134 L14P possibly damaging Het
Col4a3bp T A 13: 96,630,833 probably null Het
Crybg3 A T 16: 59,559,593 S433T possibly damaging Het
Cul9 T C 17: 46,538,497 K574R probably damaging Het
Cyp2u1 T C 3: 131,291,143 I527V probably benign Het
E130309D02Rik A G 5: 143,307,843 V293A probably benign Het
F5 A G 1: 164,219,397 N2142S probably damaging Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Flnc A G 6: 29,450,871 Y1506C probably damaging Het
Gbe1 T C 16: 70,495,370 L530P probably damaging Het
Gm8994 A T 6: 136,329,215 I225F probably damaging Het
Hmcn1 T C 1: 150,649,580 R3398G probably null Het
Igf1r T C 7: 68,187,157 L587P probably damaging Het
Kcna3 T C 3: 107,036,537 Y39H probably benign Het
Krtap5-2 GCCACAGCCTCCCTTGCAACCCCCACAGGAGCCACAGCCCCCACAGGAACTACAGCCTCCCTTGCA GCTACAGCCTCCCTTGCA 7: 142,175,243 probably benign Het
Mbl1 T C 14: 41,158,712 F186L probably damaging Het
Ncam2 A T 16: 81,589,795 K687N probably damaging Het
Nedd4l T C 18: 64,997,370 V24A probably damaging Het
Nek1 A G 8: 61,073,578 E661G probably damaging Het
Nudt14 G T 12: 112,939,320 D28E probably benign Het
Olfr1297 A T 2: 111,621,255 V273E probably damaging Het
Olfr134 T A 17: 38,175,096 I4N probably benign Het
Olfr344 T A 2: 36,569,236 C213S probably benign Het
Olfr702 T C 7: 106,824,591 probably benign Het
Pdk4 A T 6: 5,487,089 M319K probably benign Het
Pfkp T C 13: 6,593,216 N522S probably benign Het
Pias2 T C 18: 77,120,121 V234A possibly damaging Het
Pik3c2b C A 1: 133,079,774 H625Q probably benign Het
Pnpla7 T C 2: 25,051,615 S1117P probably damaging Het
Prdm2 A T 4: 143,180,894 V36D probably damaging Het
Prep C T 10: 45,092,699 R98C probably benign Het
Rae1 T C 2: 173,008,317 probably null Het
Rgs3 T A 4: 62,615,336 V138E probably damaging Het
Rnf185 T C 11: 3,425,329 T142A possibly damaging Het
Rsph6a C A 7: 19,065,647 P401Q probably damaging Het
Runx3 A T 4: 135,121,145 T14S probably benign Het
Scaf11 A G 15: 96,419,161 S841P probably damaging Het
Spta1 T A 1: 174,184,612 L328Q probably damaging Het
Sqor G A 2: 122,804,009 V318M probably damaging Het
Stox2 T C 8: 47,186,454 T902A probably benign Het
Susd3 T C 13: 49,231,203 H248R probably damaging Het
Syne1 T C 10: 5,233,406 Y4133C probably damaging Het
Tbc1d20 C T 2: 152,311,417 T289M probably benign Het
Unc80 T A 1: 66,549,784 F1036Y possibly damaging Het
Zbtb7c T C 18: 76,137,938 C366R probably damaging Het
Zeb1 A T 18: 5,772,756 D1015V probably damaging Het
Zfp606 T G 7: 12,494,039 S696A probably benign Het
Other mutations in Foxred2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01394:Foxred2 APN 15 77955620 missense probably benign 0.30
IGL01479:Foxred2 APN 15 77952289 splice site probably null
IGL01748:Foxred2 APN 15 77952346 missense probably damaging 1.00
IGL02160:Foxred2 APN 15 77955650 missense probably benign 0.03
IGL02328:Foxred2 APN 15 77955832 missense probably damaging 1.00
IGL02630:Foxred2 APN 15 77947162 missense probably benign 0.05
IGL02672:Foxred2 APN 15 77945577 critical splice donor site probably null
soma UTSW 15 77953358 missense possibly damaging 0.78
R0271:Foxred2 UTSW 15 77943390 missense possibly damaging 0.68
R1386:Foxred2 UTSW 15 77948521 critical splice acceptor site probably null
R1581:Foxred2 UTSW 15 77955761 missense possibly damaging 0.94
R4399:Foxred2 UTSW 15 77953358 missense possibly damaging 0.78
R4399:Foxred2 UTSW 15 77955680 missense probably benign 0.06
R4528:Foxred2 UTSW 15 77943249 missense probably benign 0.01
R4937:Foxred2 UTSW 15 77955835 missense probably damaging 1.00
R5165:Foxred2 UTSW 15 77956012 missense probably damaging 1.00
R5318:Foxred2 UTSW 15 77952398 missense probably benign 0.00
R5893:Foxred2 UTSW 15 77947144 missense probably damaging 1.00
R6336:Foxred2 UTSW 15 77955764 missense probably damaging 0.99
R6370:Foxred2 UTSW 15 77943306 missense probably benign 0.01
R6426:Foxred2 UTSW 15 77953308 missense probably damaging 1.00
R6826:Foxred2 UTSW 15 77947085 missense probably benign 0.01
R6891:Foxred2 UTSW 15 77955709 missense probably damaging 1.00
R6934:Foxred2 UTSW 15 77952330 nonsense probably null
Z1088:Foxred2 UTSW 15 77952003 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCCAGATCATGAAAACATCCTTG -3'
(R):5'- AGGCTTCAGGAGAGCATCTC -3'

Sequencing Primer
(F):5'- CCTGGTCTACAAAGTGAGTTCCAG -3'
(R):5'- AGAGCATCTCAGCGTGCAG -3'
Posted On2019-06-26