Incidental Mutation 'R7193:Crybg3'
ID559744
Institutional Source Beutler Lab
Gene Symbol Crybg3
Ensembl Gene ENSMUSG00000022723
Gene Namebeta-gamma crystallin domain containing 3
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R7193 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location59490775-59600979 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 59559593 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 433 (S433T)
Ref Sequence ENSEMBL: ENSMUSP00000156047 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044604] [ENSMUST00000172910]
Predicted Effect probably benign
Transcript: ENSMUST00000044604
SMART Domains Protein: ENSMUSP00000037682
Gene: ENSMUSG00000022723

DomainStartEndE-ValueType
low complexity region 258 273 N/A INTRINSIC
low complexity region 282 290 N/A INTRINSIC
XTALbg 430 516 2.78e-4 SMART
Pfam:Crystall 536 599 3.3e-7 PFAM
XTALbg 614 699 1.2e-21 SMART
XTALbg 707 790 5.73e-19 SMART
XTALbg 803 881 6.87e-5 SMART
XTALbg 889 969 1.28e-7 SMART
RICIN 972 1104 8.16e-14 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000172910
AA Change: S433T

PolyPhen 2 Score 0.869 (Sensitivity: 0.83; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A G 12: 71,219,189 probably null Het
4930402H24Rik C A 2: 130,806,788 R258L unknown Het
Abca16 T C 7: 120,427,186 S124P probably damaging Het
Acan A T 7: 79,086,342 S179C probably damaging Het
Atg2b A C 12: 105,664,708 H319Q probably damaging Het
Bptf G A 11: 107,054,809 Q2535* probably null Het
Brpf3 T C 17: 28,836,691 *1205R probably null Het
Cabyr C A 18: 12,751,758 P434Q probably damaging Het
Cacna1g C A 11: 94,409,231 D2268Y possibly damaging Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cct4 A G 11: 22,997,111 T201A probably benign Het
Cdyl2 A C 8: 116,623,994 S133A probably benign Het
Cep76 A G 18: 67,641,134 L14P possibly damaging Het
Col4a3bp T A 13: 96,630,833 probably null Het
Cul9 T C 17: 46,538,497 K574R probably damaging Het
Cyp2u1 T C 3: 131,291,143 I527V probably benign Het
E130309D02Rik A G 5: 143,307,843 V293A probably benign Het
F5 A G 1: 164,219,397 N2142S probably damaging Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Flnc A G 6: 29,450,871 Y1506C probably damaging Het
Foxred2 T A 15: 77,952,030 S376C probably damaging Het
Gbe1 T C 16: 70,495,370 L530P probably damaging Het
Gm8994 A T 6: 136,329,215 I225F probably damaging Het
Hmcn1 T C 1: 150,649,580 R3398G probably null Het
Igf1r T C 7: 68,187,157 L587P probably damaging Het
Kcna3 T C 3: 107,036,537 Y39H probably benign Het
Krtap5-2 GCCACAGCCTCCCTTGCAACCCCCACAGGAGCCACAGCCCCCACAGGAACTACAGCCTCCCTTGCA GCTACAGCCTCCCTTGCA 7: 142,175,243 probably benign Het
Mbl1 T C 14: 41,158,712 F186L probably damaging Het
Ncam2 A T 16: 81,589,795 K687N probably damaging Het
Nedd4l T C 18: 64,997,370 V24A probably damaging Het
Nek1 A G 8: 61,073,578 E661G probably damaging Het
Nudt14 G T 12: 112,939,320 D28E probably benign Het
Olfr1297 A T 2: 111,621,255 V273E probably damaging Het
Olfr134 T A 17: 38,175,096 I4N probably benign Het
Olfr344 T A 2: 36,569,236 C213S probably benign Het
Olfr702 T C 7: 106,824,591 probably benign Het
Pdk4 A T 6: 5,487,089 M319K probably benign Het
Pfkp T C 13: 6,593,216 N522S probably benign Het
Pias2 T C 18: 77,120,121 V234A possibly damaging Het
Pik3c2b C A 1: 133,079,774 H625Q probably benign Het
Pnpla7 T C 2: 25,051,615 S1117P probably damaging Het
Prdm2 A T 4: 143,180,894 V36D probably damaging Het
Prep C T 10: 45,092,699 R98C probably benign Het
Rae1 T C 2: 173,008,317 probably null Het
Rgs3 T A 4: 62,615,336 V138E probably damaging Het
Rnf185 T C 11: 3,425,329 T142A possibly damaging Het
Rsph6a C A 7: 19,065,647 P401Q probably damaging Het
Runx3 A T 4: 135,121,145 T14S probably benign Het
Scaf11 A G 15: 96,419,161 S841P probably damaging Het
Spta1 T A 1: 174,184,612 L328Q probably damaging Het
Sqor G A 2: 122,804,009 V318M probably damaging Het
Stox2 T C 8: 47,186,454 T902A probably benign Het
Susd3 T C 13: 49,231,203 H248R probably damaging Het
Syne1 T C 10: 5,233,406 Y4133C probably damaging Het
Tbc1d20 C T 2: 152,311,417 T289M probably benign Het
Unc80 T A 1: 66,549,784 F1036Y possibly damaging Het
Zbtb7c T C 18: 76,137,938 C366R probably damaging Het
Zeb1 A T 18: 5,772,756 D1015V probably damaging Het
Zfp606 T G 7: 12,494,039 S696A probably benign Het
Other mutations in Crybg3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Crybg3 APN 16 59530440 missense probably benign 0.15
IGL01305:Crybg3 APN 16 59529227 missense probably damaging 1.00
IGL01809:Crybg3 APN 16 59524853 critical splice donor site probably benign 0.00
IGL02247:Crybg3 APN 16 59503150 missense probably damaging 1.00
IGL02252:Crybg3 APN 16 59552524 splice site probably benign
IGL03036:Crybg3 APN 16 59555179 missense possibly damaging 0.68
IGL03202:Crybg3 APN 16 59494709 missense probably damaging 1.00
IGL03232:Crybg3 APN 16 59530368 missense probably damaging 1.00
ANU22:Crybg3 UTSW 16 59529227 missense probably damaging 1.00
R0052:Crybg3 UTSW 16 59565656 splice site probably benign
R0335:Crybg3 UTSW 16 59544140 missense probably damaging 1.00
R0691:Crybg3 UTSW 16 59565211 critical splice donor site probably null
R1511:Crybg3 UTSW 16 59554112 missense probably benign 0.01
R1579:Crybg3 UTSW 16 59530198 missense probably damaging 1.00
R1965:Crybg3 UTSW 16 59503237 missense probably damaging 1.00
R1982:Crybg3 UTSW 16 59544125 missense possibly damaging 0.85
R2225:Crybg3 UTSW 16 59554678 missense probably damaging 1.00
R4074:Crybg3 UTSW 16 59555757 unclassified probably null
R4210:Crybg3 UTSW 16 59544051 missense probably damaging 1.00
R4393:Crybg3 UTSW 16 59560095 unclassified probably benign
R4394:Crybg3 UTSW 16 59560095 unclassified probably benign
R4397:Crybg3 UTSW 16 59560095 unclassified probably benign
R4427:Crybg3 UTSW 16 59543199 missense probably damaging 1.00
R4578:Crybg3 UTSW 16 59530201 missense probably damaging 1.00
R4720:Crybg3 UTSW 16 59539817 missense probably damaging 1.00
R4917:Crybg3 UTSW 16 59530419 missense probably benign 0.14
R5007:Crybg3 UTSW 16 59558100 unclassified probably benign
R5020:Crybg3 UTSW 16 59554796 missense possibly damaging 0.55
R5155:Crybg3 UTSW 16 59524901 missense possibly damaging 0.91
R5306:Crybg3 UTSW 16 59559993 unclassified probably benign
R5342:Crybg3 UTSW 16 59522149 missense probably damaging 1.00
R5687:Crybg3 UTSW 16 59559166 missense probably benign 0.00
R5763:Crybg3 UTSW 16 59554610 missense possibly damaging 0.74
R5860:Crybg3 UTSW 16 59565269 missense probably damaging 1.00
R5950:Crybg3 UTSW 16 59493571 unclassified probably benign
R6007:Crybg3 UTSW 16 59554474 nonsense probably null
R6042:Crybg3 UTSW 16 59550475 missense possibly damaging 0.70
R6049:Crybg3 UTSW 16 59544054 missense probably benign 0.00
R6242:Crybg3 UTSW 16 59555690 missense probably benign
R6301:Crybg3 UTSW 16 59530338 missense probably damaging 1.00
R6408:Crybg3 UTSW 16 59495690 missense possibly damaging 0.71
R6724:Crybg3 UTSW 16 59544138 missense probably benign 0.13
R6745:Crybg3 UTSW 16 59552244 missense possibly damaging 0.93
R6777:Crybg3 UTSW 16 59558315 unclassified probably benign
R6843:Crybg3 UTSW 16 59559796 missense probably benign 0.22
R6914:Crybg3 UTSW 16 59539820 missense possibly damaging 0.89
R6942:Crybg3 UTSW 16 59539820 missense possibly damaging 0.89
R7033:Crybg3 UTSW 16 59554165 missense probably damaging 1.00
R7091:Crybg3 UTSW 16 59557168 missense possibly damaging 0.77
R7133:Crybg3 UTSW 16 59536804 missense probably damaging 1.00
R7204:Crybg3 UTSW 16 59558890 missense probably benign 0.00
R7398:Crybg3 UTSW 16 59557325 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- AGTCTGTCACAGCATGTCCC -3'
(R):5'- GACTCACAAACGGAGAGTGTTTTAG -3'

Sequencing Primer
(F):5'- CATGTCCCTGGAGAGCCATAATG -3'
(R):5'- ATGCTCATCAGTGTTTAGAGGAAGC -3'
Posted On2019-06-26