Incidental Mutation 'R7193:Brpf3'
ID559747
Institutional Source Beutler Lab
Gene Symbol Brpf3
Ensembl Gene ENSMUSG00000063952
Gene Namebromodomain and PHD finger containing, 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.464) question?
Stock #R7193 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location28801090-28838546 bp(+) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) T to C at 28836691 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Arginine at position 1205 (*1205R)
Ref Sequence ENSEMBL: ENSMUSP00000004985 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004985]
Predicted Effect probably null
Transcript: ENSMUST00000004985
AA Change: *1205R
SMART Domains Protein: ENSMUSP00000004985
Gene: ENSMUSG00000063952
AA Change: *1205R

DomainStartEndE-ValueType
Pfam:EPL1 48 194 8.4e-38 PFAM
PHD 214 260 7.07e-5 SMART
PHD 324 387 4.74e-6 SMART
low complexity region 405 436 N/A INTRINSIC
Blast:BROMO 491 534 7e-21 BLAST
low complexity region 558 577 N/A INTRINSIC
BROMO 586 694 4.93e-39 SMART
low complexity region 777 792 N/A INTRINSIC
low complexity region 813 823 N/A INTRINSIC
PWWP 1073 1156 2.07e-38 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (60/60)
MGI Phenotype PHENOTYPE: Homozygous knockout does not result in any obvious neurological, behavioral, developmental, histological, hematological, survival or reproductive phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A G 12: 71,219,189 probably null Het
4930402H24Rik C A 2: 130,806,788 R258L unknown Het
Abca16 T C 7: 120,427,186 S124P probably damaging Het
Acan A T 7: 79,086,342 S179C probably damaging Het
Atg2b A C 12: 105,664,708 H319Q probably damaging Het
Bptf G A 11: 107,054,809 Q2535* probably null Het
Cabyr C A 18: 12,751,758 P434Q probably damaging Het
Cacna1g C A 11: 94,409,231 D2268Y possibly damaging Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cct4 A G 11: 22,997,111 T201A probably benign Het
Cdyl2 A C 8: 116,623,994 S133A probably benign Het
Cep76 A G 18: 67,641,134 L14P possibly damaging Het
Col4a3bp T A 13: 96,630,833 probably null Het
Crybg3 A T 16: 59,559,593 S433T possibly damaging Het
Cul9 T C 17: 46,538,497 K574R probably damaging Het
Cyp2u1 T C 3: 131,291,143 I527V probably benign Het
E130309D02Rik A G 5: 143,307,843 V293A probably benign Het
F5 A G 1: 164,219,397 N2142S probably damaging Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Flnc A G 6: 29,450,871 Y1506C probably damaging Het
Foxred2 T A 15: 77,952,030 S376C probably damaging Het
Gbe1 T C 16: 70,495,370 L530P probably damaging Het
Gm8994 A T 6: 136,329,215 I225F probably damaging Het
Hmcn1 T C 1: 150,649,580 R3398G probably null Het
Igf1r T C 7: 68,187,157 L587P probably damaging Het
Kcna3 T C 3: 107,036,537 Y39H probably benign Het
Krtap5-2 GCCACAGCCTCCCTTGCAACCCCCACAGGAGCCACAGCCCCCACAGGAACTACAGCCTCCCTTGCA GCTACAGCCTCCCTTGCA 7: 142,175,243 probably benign Het
Mbl1 T C 14: 41,158,712 F186L probably damaging Het
Ncam2 A T 16: 81,589,795 K687N probably damaging Het
Nedd4l T C 18: 64,997,370 V24A probably damaging Het
Nek1 A G 8: 61,073,578 E661G probably damaging Het
Nudt14 G T 12: 112,939,320 D28E probably benign Het
Olfr1297 A T 2: 111,621,255 V273E probably damaging Het
Olfr134 T A 17: 38,175,096 I4N probably benign Het
Olfr344 T A 2: 36,569,236 C213S probably benign Het
Olfr702 T C 7: 106,824,591 probably benign Het
Pdk4 A T 6: 5,487,089 M319K probably benign Het
Pfkp T C 13: 6,593,216 N522S probably benign Het
Pias2 T C 18: 77,120,121 V234A possibly damaging Het
Pik3c2b C A 1: 133,079,774 H625Q probably benign Het
Pnpla7 T C 2: 25,051,615 S1117P probably damaging Het
Prdm2 A T 4: 143,180,894 V36D probably damaging Het
Prep C T 10: 45,092,699 R98C probably benign Het
Rae1 T C 2: 173,008,317 probably null Het
Rgs3 T A 4: 62,615,336 V138E probably damaging Het
Rnf185 T C 11: 3,425,329 T142A possibly damaging Het
Rsph6a C A 7: 19,065,647 P401Q probably damaging Het
Runx3 A T 4: 135,121,145 T14S probably benign Het
Scaf11 A G 15: 96,419,161 S841P probably damaging Het
Spta1 T A 1: 174,184,612 L328Q probably damaging Het
Sqor G A 2: 122,804,009 V318M probably damaging Het
Stox2 T C 8: 47,186,454 T902A probably benign Het
Susd3 T C 13: 49,231,203 H248R probably damaging Het
Syne1 T C 10: 5,233,406 Y4133C probably damaging Het
Tbc1d20 C T 2: 152,311,417 T289M probably benign Het
Unc80 T A 1: 66,549,784 F1036Y possibly damaging Het
Zbtb7c T C 18: 76,137,938 C366R probably damaging Het
Zeb1 A T 18: 5,772,756 D1015V probably damaging Het
Zfp606 T G 7: 12,494,039 S696A probably benign Het
Other mutations in Brpf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00906:Brpf3 APN 17 28836700 utr 3 prime probably benign
IGL01397:Brpf3 APN 17 28817632 missense probably benign 0.22
IGL01608:Brpf3 APN 17 28821517 missense probably benign 0.00
IGL02073:Brpf3 APN 17 28807396 missense probably benign
IGL02540:Brpf3 APN 17 28828354 missense probably damaging 1.00
IGL02838:Brpf3 APN 17 28835784 missense probably benign 0.19
IGL02888:Brpf3 APN 17 28828391 missense probably damaging 1.00
IGL02969:Brpf3 APN 17 28821305 missense probably benign 0.05
IGL03036:Brpf3 APN 17 28824048 missense possibly damaging 0.89
IGL03084:Brpf3 APN 17 28835777 missense probably damaging 0.98
R0448:Brpf3 UTSW 17 28806036 missense probably benign 0.10
R0898:Brpf3 UTSW 17 28806990 missense possibly damaging 0.65
R1268:Brpf3 UTSW 17 28836556 missense probably damaging 0.98
R1639:Brpf3 UTSW 17 28824068 critical splice donor site probably null
R1754:Brpf3 UTSW 17 28821323 missense probably benign 0.00
R1867:Brpf3 UTSW 17 28807368 missense probably benign
R1954:Brpf3 UTSW 17 28806559 missense probably benign
R2000:Brpf3 UTSW 17 28821557 missense probably benign 0.20
R2064:Brpf3 UTSW 17 28821364 missense probably benign
R2209:Brpf3 UTSW 17 28828420 missense probably damaging 0.98
R2413:Brpf3 UTSW 17 28805950 start gained probably benign
R3977:Brpf3 UTSW 17 28807042 missense possibly damaging 0.49
R4067:Brpf3 UTSW 17 28821259 missense probably benign
R4291:Brpf3 UTSW 17 28823975 missense probably benign 0.00
R4369:Brpf3 UTSW 17 28836620 missense probably damaging 1.00
R4371:Brpf3 UTSW 17 28836620 missense probably damaging 1.00
R4741:Brpf3 UTSW 17 28817784 missense possibly damaging 0.50
R4773:Brpf3 UTSW 17 28821259 missense probably benign 0.00
R4824:Brpf3 UTSW 17 28806486 missense probably benign
R5360:Brpf3 UTSW 17 28810562 missense probably benign
R5923:Brpf3 UTSW 17 28806636 missense possibly damaging 0.90
R6181:Brpf3 UTSW 17 28810581 missense probably damaging 1.00
R6278:Brpf3 UTSW 17 28821284 missense probably benign 0.00
R6702:Brpf3 UTSW 17 28810659 missense probably benign 0.01
R6884:Brpf3 UTSW 17 28831350 missense probably benign 0.03
R6920:Brpf3 UTSW 17 28823996 missense probably benign 0.34
R6976:Brpf3 UTSW 17 28835777 missense probably damaging 0.98
R7099:Brpf3 UTSW 17 28806637 missense probably benign 0.06
R7108:Brpf3 UTSW 17 28817125 missense probably benign 0.01
R7316:Brpf3 UTSW 17 28814686 missense probably damaging 1.00
R7326:Brpf3 UTSW 17 28806293 missense probably benign 0.00
R7403:Brpf3 UTSW 17 28821356 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGCTTCCAAGGGACAAAGTC -3'
(R):5'- GTTCTTCAGTGGAATATCCCCAGG -3'

Sequencing Primer
(F):5'- ACAAAGTCCTGCCCCTGG -3'
(R):5'- CACAGCAGCCCTCCAGG -3'
Posted On2019-06-26