Incidental Mutation 'R7193:Olfr134'
ID559748
Institutional Source Beutler Lab
Gene Symbol Olfr134
Ensembl Gene ENSMUSG00000096009
Gene Nameolfactory receptor 134
SynonymsMOR256-5, GA_x6K02T2PSCP-2623613-2624551
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R7193 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location38171388-38176578 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 38175096 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 4 (I4N)
Ref Sequence ENSEMBL: ENSMUSP00000151069 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074883] [ENSMUST00000215900]
Predicted Effect probably benign
Transcript: ENSMUST00000074883
AA Change: I4N

PolyPhen 2 Score 0.442 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000074423
Gene: ENSMUSG00000096009
AA Change: I4N

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 3.4e-50 PFAM
Pfam:7tm_1 41 290 2e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215900
AA Change: I4N

PolyPhen 2 Score 0.442 (Sensitivity: 0.89; Specificity: 0.90)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A G 12: 71,219,189 probably null Het
4930402H24Rik C A 2: 130,806,788 R258L unknown Het
Abca16 T C 7: 120,427,186 S124P probably damaging Het
Acan A T 7: 79,086,342 S179C probably damaging Het
Atg2b A C 12: 105,664,708 H319Q probably damaging Het
Bptf G A 11: 107,054,809 Q2535* probably null Het
Brpf3 T C 17: 28,836,691 *1205R probably null Het
Cabyr C A 18: 12,751,758 P434Q probably damaging Het
Cacna1g C A 11: 94,409,231 D2268Y possibly damaging Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cct4 A G 11: 22,997,111 T201A probably benign Het
Cdyl2 A C 8: 116,623,994 S133A probably benign Het
Cep76 A G 18: 67,641,134 L14P possibly damaging Het
Col4a3bp T A 13: 96,630,833 probably null Het
Crybg3 A T 16: 59,559,593 S433T possibly damaging Het
Cul9 T C 17: 46,538,497 K574R probably damaging Het
Cyp2u1 T C 3: 131,291,143 I527V probably benign Het
E130309D02Rik A G 5: 143,307,843 V293A probably benign Het
F5 A G 1: 164,219,397 N2142S probably damaging Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Flnc A G 6: 29,450,871 Y1506C probably damaging Het
Foxred2 T A 15: 77,952,030 S376C probably damaging Het
Gbe1 T C 16: 70,495,370 L530P probably damaging Het
Gm8994 A T 6: 136,329,215 I225F probably damaging Het
Hmcn1 T C 1: 150,649,580 R3398G probably null Het
Igf1r T C 7: 68,187,157 L587P probably damaging Het
Kcna3 T C 3: 107,036,537 Y39H probably benign Het
Krtap5-2 GCCACAGCCTCCCTTGCAACCCCCACAGGAGCCACAGCCCCCACAGGAACTACAGCCTCCCTTGCA GCTACAGCCTCCCTTGCA 7: 142,175,243 probably benign Het
Mbl1 T C 14: 41,158,712 F186L probably damaging Het
Ncam2 A T 16: 81,589,795 K687N probably damaging Het
Nedd4l T C 18: 64,997,370 V24A probably damaging Het
Nek1 A G 8: 61,073,578 E661G probably damaging Het
Nudt14 G T 12: 112,939,320 D28E probably benign Het
Olfr1297 A T 2: 111,621,255 V273E probably damaging Het
Olfr344 T A 2: 36,569,236 C213S probably benign Het
Olfr702 T C 7: 106,824,591 probably benign Het
Pdk4 A T 6: 5,487,089 M319K probably benign Het
Pfkp T C 13: 6,593,216 N522S probably benign Het
Pias2 T C 18: 77,120,121 V234A possibly damaging Het
Pik3c2b C A 1: 133,079,774 H625Q probably benign Het
Pnpla7 T C 2: 25,051,615 S1117P probably damaging Het
Prdm2 A T 4: 143,180,894 V36D probably damaging Het
Prep C T 10: 45,092,699 R98C probably benign Het
Rae1 T C 2: 173,008,317 probably null Het
Rgs3 T A 4: 62,615,336 V138E probably damaging Het
Rnf185 T C 11: 3,425,329 T142A possibly damaging Het
Rsph6a C A 7: 19,065,647 P401Q probably damaging Het
Runx3 A T 4: 135,121,145 T14S probably benign Het
Scaf11 A G 15: 96,419,161 S841P probably damaging Het
Spta1 T A 1: 174,184,612 L328Q probably damaging Het
Sqor G A 2: 122,804,009 V318M probably damaging Het
Stox2 T C 8: 47,186,454 T902A probably benign Het
Susd3 T C 13: 49,231,203 H248R probably damaging Het
Syne1 T C 10: 5,233,406 Y4133C probably damaging Het
Tbc1d20 C T 2: 152,311,417 T289M probably benign Het
Unc80 T A 1: 66,549,784 F1036Y possibly damaging Het
Zbtb7c T C 18: 76,137,938 C366R probably damaging Het
Zeb1 A T 18: 5,772,756 D1015V probably damaging Het
Zfp606 T G 7: 12,494,039 S696A probably benign Het
Other mutations in Olfr134
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01677:Olfr134 APN 17 38175875 missense probably damaging 1.00
IGL01749:Olfr134 APN 17 38175686 missense probably benign 0.04
IGL01750:Olfr134 APN 17 38175686 missense probably benign 0.04
IGL01751:Olfr134 APN 17 38175686 missense probably benign 0.04
IGL01753:Olfr134 APN 17 38175686 missense probably benign 0.04
IGL01757:Olfr134 APN 17 38175686 missense probably benign 0.04
IGL01765:Olfr134 APN 17 38175686 missense probably benign 0.04
IGL01766:Olfr134 APN 17 38175686 missense probably benign 0.04
IGL01767:Olfr134 APN 17 38175686 missense probably benign 0.04
IGL01822:Olfr134 APN 17 38175448 missense probably damaging 1.00
IGL02256:Olfr134 APN 17 38175686 missense probably benign 0.04
IGL02257:Olfr134 APN 17 38175686 missense probably benign 0.04
IGL02258:Olfr134 APN 17 38175686 missense probably benign 0.04
IGL02259:Olfr134 APN 17 38175686 missense probably benign 0.04
IGL02275:Olfr134 APN 17 38175686 missense probably benign 0.04
IGL02293:Olfr134 APN 17 38175686 missense probably benign 0.04
IGL02295:Olfr134 APN 17 38175686 missense probably benign 0.04
IGL02317:Olfr134 APN 17 38175686 missense probably benign 0.04
IGL02318:Olfr134 APN 17 38175686 missense probably benign 0.04
R0230:Olfr134 UTSW 17 38175950 missense probably damaging 1.00
R0363:Olfr134 UTSW 17 38175447 missense probably damaging 1.00
R1074:Olfr134 UTSW 17 38175440 missense probably damaging 1.00
R1506:Olfr134 UTSW 17 38175200 missense probably benign
R2300:Olfr134 UTSW 17 38175550 nonsense probably null
R3743:Olfr134 UTSW 17 38175902 missense probably damaging 1.00
R3975:Olfr134 UTSW 17 38175495 missense probably benign 0.03
R4230:Olfr134 UTSW 17 38175881 missense possibly damaging 0.67
R5158:Olfr134 UTSW 17 38175454 nonsense probably null
R5439:Olfr134 UTSW 17 38176026 unclassified probably null
R6144:Olfr134 UTSW 17 38175225 missense probably damaging 1.00
R6309:Olfr134 UTSW 17 38175519 missense probably benign 0.00
R6675:Olfr134 UTSW 17 38176014 missense probably benign
R6800:Olfr134 UTSW 17 38175122 missense probably benign 0.01
R6873:Olfr134 UTSW 17 38175368 missense probably benign
X0011:Olfr134 UTSW 17 38175851 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCACAAAGCTCTATATGGAC -3'
(R):5'- GCATCTGAGGTACAATGCTTGTG -3'

Sequencing Primer
(F):5'- ATGGACTGATGTGTCTCCTAAC -3'
(R):5'- TGTGGTGTAGCACATGTCTAGAAAG -3'
Posted On2019-06-26