Incidental Mutation 'R7193:Pias2'
ID559755
Institutional Source Beutler Lab
Gene Symbol Pias2
Ensembl Gene ENSMUSG00000025423
Gene Nameprotein inhibitor of activated STAT 2
SynonymsARIP3, Miz1, PIASxalpha, PIASxbeta, Dib, 6330408K17Rik, PIASxb
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7193 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location77065208-77155708 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 77120121 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 234 (V234A)
Ref Sequence ENSEMBL: ENSMUSP00000110425 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114776] [ENSMUST00000114777] [ENSMUST00000168882]
Predicted Effect possibly damaging
Transcript: ENSMUST00000114776
AA Change: V227A

PolyPhen 2 Score 0.762 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000110424
Gene: ENSMUSG00000025423
AA Change: V227A

DomainStartEndE-ValueType
SAP 4 38 2.01e-5 SMART
low complexity region 95 110 N/A INTRINSIC
Pfam:PINIT 134 290 7e-45 PFAM
Pfam:zf-MIZ 335 384 4.9e-24 PFAM
low complexity region 468 476 N/A INTRINSIC
low complexity region 502 515 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114777
AA Change: V234A

PolyPhen 2 Score 0.762 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000110425
Gene: ENSMUSG00000025423
AA Change: V234A

DomainStartEndE-ValueType
SAP 11 45 2.01e-5 SMART
low complexity region 102 117 N/A INTRINSIC
low complexity region 135 144 N/A INTRINSIC
Pfam:PINIT 145 297 4.8e-38 PFAM
Pfam:zf-MIZ 342 391 1.7e-24 PFAM
low complexity region 475 483 N/A INTRINSIC
low complexity region 509 522 N/A INTRINSIC
low complexity region 571 610 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000168882
AA Change: V227A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131485
Gene: ENSMUSG00000025423
AA Change: V227A

DomainStartEndE-ValueType
SAP 4 38 2.01e-5 SMART
low complexity region 95 110 N/A INTRINSIC
Pfam:PINIT 134 290 2.3e-44 PFAM
Pfam:zf-MIZ 335 384 2.6e-23 PFAM
low complexity region 468 476 N/A INTRINSIC
low complexity region 502 515 N/A INTRINSIC
low complexity region 564 603 N/A INTRINSIC
Meta Mutation Damage Score 0.236 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the protein inhibitor of activated STAT (PIAS) family. PIAS proteins function as SUMO E3 ligases and play important roles in many cellular processes by mediating the sumoylation of target proteins. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. Isoforms of the encoded protein enhance the sumoylation of specific target proteins including the p53 tumor suppressor protein, c-Jun, and the androgen receptor. A pseudogene of this gene is located on the short arm of chromosome 4. The symbol MIZ1 has also been associated with ZBTB17 which is a different gene located on chromosome 1. [provided by RefSeq, Aug 2011]
PHENOTYPE: An uncharacterized gene trap insertion does not result in an obvious phenotype although abnormalities are reported in the testes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A G 12: 71,219,189 probably null Het
4930402H24Rik C A 2: 130,806,788 R258L unknown Het
Abca16 T C 7: 120,427,186 S124P probably damaging Het
Acan A T 7: 79,086,342 S179C probably damaging Het
Atg2b A C 12: 105,664,708 H319Q probably damaging Het
Bptf G A 11: 107,054,809 Q2535* probably null Het
Brpf3 T C 17: 28,836,691 *1205R probably null Het
Cabyr C A 18: 12,751,758 P434Q probably damaging Het
Cacna1g C A 11: 94,409,231 D2268Y possibly damaging Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cct4 A G 11: 22,997,111 T201A probably benign Het
Cdyl2 A C 8: 116,623,994 S133A probably benign Het
Cep76 A G 18: 67,641,134 L14P possibly damaging Het
Col4a3bp T A 13: 96,630,833 probably null Het
Crybg3 A T 16: 59,559,593 S433T possibly damaging Het
Cul9 T C 17: 46,538,497 K574R probably damaging Het
Cyp2u1 T C 3: 131,291,143 I527V probably benign Het
E130309D02Rik A G 5: 143,307,843 V293A probably benign Het
F5 A G 1: 164,219,397 N2142S probably damaging Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Flnc A G 6: 29,450,871 Y1506C probably damaging Het
Foxred2 T A 15: 77,952,030 S376C probably damaging Het
Gbe1 T C 16: 70,495,370 L530P probably damaging Het
Gm8994 A T 6: 136,329,215 I225F probably damaging Het
Hmcn1 T C 1: 150,649,580 R3398G probably null Het
Igf1r T C 7: 68,187,157 L587P probably damaging Het
Kcna3 T C 3: 107,036,537 Y39H probably benign Het
Krtap5-2 GCCACAGCCTCCCTTGCAACCCCCACAGGAGCCACAGCCCCCACAGGAACTACAGCCTCCCTTGCA GCTACAGCCTCCCTTGCA 7: 142,175,243 probably benign Het
Mbl1 T C 14: 41,158,712 F186L probably damaging Het
Ncam2 A T 16: 81,589,795 K687N probably damaging Het
Nedd4l T C 18: 64,997,370 V24A probably damaging Het
Nek1 A G 8: 61,073,578 E661G probably damaging Het
Nudt14 G T 12: 112,939,320 D28E probably benign Het
Olfr1297 A T 2: 111,621,255 V273E probably damaging Het
Olfr134 T A 17: 38,175,096 I4N probably benign Het
Olfr344 T A 2: 36,569,236 C213S probably benign Het
Olfr702 T C 7: 106,824,591 probably benign Het
Pdk4 A T 6: 5,487,089 M319K probably benign Het
Pfkp T C 13: 6,593,216 N522S probably benign Het
Pik3c2b C A 1: 133,079,774 H625Q probably benign Het
Pnpla7 T C 2: 25,051,615 S1117P probably damaging Het
Prdm2 A T 4: 143,180,894 V36D probably damaging Het
Prep C T 10: 45,092,699 R98C probably benign Het
Rae1 T C 2: 173,008,317 probably null Het
Rgs3 T A 4: 62,615,336 V138E probably damaging Het
Rnf185 T C 11: 3,425,329 T142A possibly damaging Het
Rsph6a C A 7: 19,065,647 P401Q probably damaging Het
Runx3 A T 4: 135,121,145 T14S probably benign Het
Scaf11 A G 15: 96,419,161 S841P probably damaging Het
Spta1 T A 1: 174,184,612 L328Q probably damaging Het
Sqor G A 2: 122,804,009 V318M probably damaging Het
Stox2 T C 8: 47,186,454 T902A probably benign Het
Susd3 T C 13: 49,231,203 H248R probably damaging Het
Syne1 T C 10: 5,233,406 Y4133C probably damaging Het
Tbc1d20 C T 2: 152,311,417 T289M probably benign Het
Unc80 T A 1: 66,549,784 F1036Y possibly damaging Het
Zbtb7c T C 18: 76,137,938 C366R probably damaging Het
Zeb1 A T 18: 5,772,756 D1015V probably damaging Het
Zfp606 T G 7: 12,494,039 S696A probably benign Het
Other mutations in Pias2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Pias2 APN 18 77133211 missense probably damaging 1.00
IGL01105:Pias2 APN 18 77133156 missense probably damaging 1.00
IGL02379:Pias2 APN 18 77145148 splice site probably benign
IGL02932:Pias2 APN 18 77145103 missense probably damaging 1.00
IGL03181:Pias2 APN 18 77133242 missense possibly damaging 0.83
IGL03389:Pias2 APN 18 77097658 missense probably damaging 1.00
IGL03138:Pias2 UTSW 18 77150100 critical splice donor site probably null
R0492:Pias2 UTSW 18 77105885 missense probably damaging 1.00
R0577:Pias2 UTSW 18 77097281 missense probably damaging 1.00
R1660:Pias2 UTSW 18 77120129 missense probably damaging 1.00
R1866:Pias2 UTSW 18 77152716 missense probably benign 0.03
R1901:Pias2 UTSW 18 77097443 nonsense probably null
R1996:Pias2 UTSW 18 77129063 critical splice donor site probably null
R2107:Pias2 UTSW 18 77097471 missense probably benign 0.35
R4439:Pias2 UTSW 18 77097703 missense probably damaging 1.00
R4603:Pias2 UTSW 18 77130107 missense probably damaging 0.99
R4747:Pias2 UTSW 18 77152792 makesense probably null
R4816:Pias2 UTSW 18 77105891 critical splice donor site probably null
R5697:Pias2 UTSW 18 77133188 missense probably damaging 1.00
R6265:Pias2 UTSW 18 77097258 missense probably damaging 1.00
R6375:Pias2 UTSW 18 77152670 missense possibly damaging 0.96
R6545:Pias2 UTSW 18 77130085 missense possibly damaging 0.61
R6713:Pias2 UTSW 18 77065720 utr 5 prime probably null
R7232:Pias2 UTSW 18 77133235 missense probably benign 0.02
R7253:Pias2 UTSW 18 77120115 missense probably damaging 0.97
R7259:Pias2 UTSW 18 77152720 missense possibly damaging 0.73
X0009:Pias2 UTSW 18 77145097 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ACACAGTCCAAGTCCAGCTG -3'
(R):5'- GCTCAGCTGTTAGATATGATCCAAG -3'

Sequencing Primer
(F):5'- AAGTCCAGCTGCGGTGAG -3'
(R):5'- GATCCAAGAGTCAATCAAAACTTTG -3'
Posted On2019-06-26